Human GNAQ/G-ALPHA-q/GAQ ORF/cDNA clone-Adenovirus particle (BC057777)

Cat. No.: vGMAP000230

Pre-made Human GNAQ/G-ALPHA-q/GAQ Adenovirus for GNAQ overexpression in-vitro and in-vivo. The GNAQ adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GNAQ-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to GNAQ/G-ALPHA-q products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000230 Human GNAQ Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000230
Gene Name GNAQ
Accession Number BC057777
Gene ID 2776
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1080 bp
Gene Alias G-ALPHA-q,GAQ
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGACTCTGGAGTCCATCATGGCGTGCTGCCTGAGCGAGGAGGCCAAGGAAGCCCGGCGGATCAACGACGAGATCGAGCGGCAGCTCCGCAGGGACAAGCGGGACGCCCGCCGGGAGCTCAAGCTGCTGCTGCTCGGGACAGGAGAGAGTGGCAAGAGTACGTTTATCAAGCAGATGAGAATCATCCATGGGTCAGGATACTCTGATGAAGATAAAAGGGGCTTCACCAAGCTGGTGTATCAGAACATCTTCACGGCCATGCAGGCCATGATCAGAGCCATGGACACACTCAAGATCCCATACAAGTATGAGCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCAGAACTCCTCGGTTATTCTGTTCTTAAACAAGAAAGATCTTCTAGAGGAGAAAATCATGTATTCCCATCTAGTCGACTACTTCCCAGAATATGATGGACCCCAGAGAGATGCCCAGGCAGCCCGAGAATTCATTCTGAAGATGTTCGTGGACCTGAACCCAGACAGTGACAAAATTATCTACTCCCACTTCACGTGCGCCACAGACACCGAGAATATCCGCTTTGTCTTTGCTGCCGTCAAGGACACCATCCTCCAGTTGAACCTGAAGGAGTACAATCTGGTCTAA
ORF Protein Sequence MTLESIMACCLSEEAKEARRINDEIERQLRRDKRDARRELKLLLLGTGESGKSTFIKQMRIIHGSGYSDEDKRGFTKLVYQNIFTAMQAMIRAMDTLKIPYKYEHNKAHAQLVREVDVEKVSAFENPYVDAIKSLWNDPGIQECYDRRREYQLSDSTKYYLNDLDRVADPAYLPTQQDVLRVRVPTTGIIEYPFDLQSVIFRMVDVGGQRSERRKWIHCFENVTSIMFLVALSEYDQVLVESDNENRMEESKALFRTIITYPWFQNSSVILFLNKKDLLEEKIMYSHLVDYFPEYDGPQRDAQAAREFILKMFVDLNPDSDKIIYSHFTCATDTENIRFVFAAVKDTILQLNLKEYNLV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12290-Ab Anti-GNAQ/ CMC1/ G-ALPHA-q monoclonal antibody
    Target Antigen GM-Tg-g-T12290-Ag GNAQ VLP (virus-like particle)
    ORF Viral Vector pGMAP000230 Human GNAQ Adenovirus plasmid
    ORF Viral Vector pGMPC000997 Human GNAQ Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAP000230 Human GNAQ Adenovirus particle


    Target information

    Target ID GM-T12290
    Target Name GNAQ
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2776
    Gene ID 100063136 (Equus caballus), 101094708 (Felis catus), 14682 (Mus musculus), 2776 (Homo sapiens)
    403928 (Canis lupus familiaris), 81666 (Rattus norvegicus)
    Gene Symbols & Synonyms GNAQ,Gnaq,Gq,GqI,Dsk1,Dsk10,Galphaq,1110005L02Rik,6230401I02Rik,GAQ,SWS,CMAL,CMC1,G-ALPHA-q
    Target Alternative Names 1110005L02Rik,6230401I02Rik,CMAL,CMC1,Dsk1,Dsk10,G-ALPHA-q,GAQ,GNAQ,Galphaq,Gnaq,Gq,GqI,Guanine nucleotide-binding protein G(q) subunit alpha,Guanine nucleotide-binding protein alpha-q,SWS
    Uniprot Accession P21279,P50148,P82471,Q28294
    Additional SwissProt Accessions: P21279,P50148,Q28294,P82471
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Rap1 signaling pathway, Calcium signaling pathway, cGMP-PKG signaling pathway, Chemokine signaling pathway, Sphingolipid signaling pathway, Adrenergic signaling in cardiomyocytes, Vascular smooth muscle contraction, Gap junction, Platelet activation, Circadian entrainment, Long-term potentiation, Glutamatergic synapse, Cholinergic synapse, Serotonergic synapse, Inflammatory mediator regulation of TRP channels, Insulin secretion, GnRH signaling pathway, Melanogenesis, Thyroid hormone synthesis, Oxytocin signaling pathway, Renin secretion, Aldosterone synthesis and secretion, Cortisol synthesis and secretion, Parathyroid hormone synthesis, secretion and action, GnRH secretion, Cushing syndrome, Growth hormone synthesis, secretion and action, Salivary secretion, Gastric acid secretion, Pancreatic secretion, Alzheimer disease, Yersinia infection, Chagas disease, African trypanosomiasis, Amoebiasis, Human cytomegalovirus infection, Pathways in cancer
    Gene Ensembl ENSECAG00000018363, ENSMUSG00000024639, ENSG00000156052, ENSCAFG00845009564
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.