Human TM4SF1/H-L6/L6 ORF/cDNA clone-Lentivirus plasmid (NM_014220)

Cat. No.: pGMLP003951
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TM4SF1/H-L6/L6 Lentiviral expression plasmid for TM4SF1 lentivirus packaging, TM4SF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TM4SF1/H-L6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $452.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003951
Gene Name TM4SF1
Accession Number NM_014220
Gene ID 4071
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 609 bp
Gene Alias H-L6,L6,M3S1,TAAL6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGCTATGGGAAGTGTGCACGATGCATCGGACATTCTCTGGTGGGGCTCGCCCTCCTGTGCATCGCGGCTAATATTTTGCTTTACTTTCCCAATGGGGAAACAAAGTATGCCTCCGAAAACCACCTCAGCCGCTTCGTGTGGTTCTTTTCTGGCATCGTAGGAGGTGGCCTGCTGATGCTCCTGCCAGCATTTGTCTTCATTGGGCTGGAACAGGATGACTGCTGTGGCTGCTGTGGCCATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAA
ORF Protein Sequence MCYGKCARCIGHSLVGLALLCIAANILLYFPNGETKYASENHLSRFVWFFSGIVGGGLLMLLPAFVFIGLEQDDCCGCCGHENCGKRCAMLSSVLAALIGIAGSGYCVIVAALGLAEGPLCLDSLGQWNYTFASTEGQYLLDTSTWSECTEPKHIVEWNVSLFSILLALGGIEFILCLIQVINGVLGGICGFCCSHQQQYDC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1922-Ab Anti-TM4SF1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1922-Ag TM4SF1 protein
    ORF Viral Vector pGMLP003951 Human TM4SF1 Lentivirus plasmid
    ORF Viral Vector pGMLP004020 Human TM4SF1 Lentivirus plasmid
    ORF Viral Vector vGMLP003951 Human TM4SF1 Lentivirus particle
    ORF Viral Vector vGMLP004020 Human TM4SF1 Lentivirus particle


    Target information

    Target ID GM-IP1922
    Target Name TM4SF1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    4071
    Gene ID 100050742 (Equus caballus), 101101157 (Felis catus), 17112 (Mus musculus), 295061 (Rattus norvegicus)
    4071 (Homo sapiens), 485710 (Canis lupus familiaris), 533038 (Bos taurus), 711908 (Macaca mulatta)
    Gene Symbols & Synonyms TM4SF1,Tm4sf1,L6,M3s1,H-L6,M3S1,TAAL6
    Target Alternative Names H-L6,L6,M3S1,M3s1,Membrane component chromosome 3 surface marker 1,TAAL6,TM4SF1,Tm4sf1,Transmembrane 4 L6 family member 1,Tumor-associated antigen L6
    Uniprot Accession P30408,Q64302
    Additional SwissProt Accessions: Q64302,P30408
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000019071, ENSMUSG00000027800, ENSG00000169908, ENSCAFG00845023992, ENSBTAG00000015163, ENSMMUG00000052736
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.