Human BNIP3L/BNIP3a/NIX ORF/cDNA clone-Lentivirus plasmid (NM_004331)
Cat. No.: pGMLP-SPh-117
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human BNIP3L/BNIP3a/NIX Lentiviral expression plasmid for BNIP3L lentivirus packaging, BNIP3L lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
BNIP3L/BNIP3a products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP-SPh-117 |
Gene Name | BNIP3L |
Accession Number | NM_004331 |
Gene ID | 665 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 660 bp |
Gene Alias | BNIP3a,NIX |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCGTCCCACCTAGTCGAGCCGCCGCCGCCCCTGCACAACAACAACAACAACTGCGAGGAAAATGAGCAGTCTCTGCCCCCGCCGGCCGGCCTCAACAGTTCCTGGGTGGAGCTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGAAGAAAGGGGGTATTTTCTCCGCAGAATTTCTGAAGGTGTTCATTCCATCTCTCTTCCTTTCTCATGTTTTGGCTTTGGGGCTAGGCATCTATATTGGAAAGCGACTGAGCACACCCTCTGCCAGCACCTACTGA |
ORF Protein Sequence | MSSHLVEPPPPLHNNNNNCEENEQSLPPPAGLNSSWVELPMNSSNGNDNGNGKNGGLEHVPSSSSIHNGDMEKILLDAQHESGQSSSRGSSHCDSPSPQEDGQIMFDVEMHTSRDHSSQSEEEVVEGEKEVEALKKSADWVSDWSSRPENIPPKEFHFRHPKRSVSLSMRKSGAMKKGGIFSAEFLKVFIPSLFLSHVLALGLGIYIGKRLSTPSASTY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0427-Ab | Anti-BNIP3L monoclonal antibody |
Target Antigen | GM-Tg-g-IP0427-Ag | BNIP3L protein |
ORF Viral Vector | pGMLP000351 | Human BNIP3L Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-117 | Human BNIP3L Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-257 | Human BNIP3L Adenovirus plasmid |
ORF Viral Vector | pGMPC000336 | Human BNIP3L Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP000351 | Human BNIP3L Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-117 | Human BNIP3L Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-257 | Human BNIP3L Adenovirus particle |
Target information
Target ID | GM-IP0427 |
Target Name | BNIP3L |
Gene Group Identifier (Target Gene ID in Homo species) |
665 |
Gene ID |
100054317 (Equus caballus), 101099293 (Felis catus), 12177 (Mus musculus), 140923 (Rattus norvegicus) 534615 (Bos taurus), 608552 (Canis lupus familiaris), 641440 (Macaca mulatta), 665 (Homo sapiens) |
Gene Symbols & Synonyms | BNIP3L,Bnip3l,Nix,Nip3L,D14Ertd719e,UV93,NIX,NIP3L,BNIP3a |
Target Alternative Names | BNIP3L,BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like,Adenovirus E1B19K-binding protein B5, BCL2/adenovirus E1B 19 kDa protein-interacting protein 3A, NIP3-like protein X (NIP3L),NIX,NIP3L,BNIP3a |
Uniprot Accession |
O60238,Q3T013,Q9Z2F7
Additional SwissProt Accessions: Q9Z2F7,Q3T013,O60238 |
Uniprot Entry Name | |
Protein Sub-location | Introcelluar Protein |
Category | |
Disease | cancer |
Disease from KEGG | |
Gene Ensembl | ENSECAG00000005770, ENSMUSG00000022051, ENSBTAG00000021307, ENSMMUG00000023646, ENSG00000104765 |
Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.