Human BNIP3L/BNIP3a/NIX ORF/cDNA clone-Adenovirus plasmid (NM_004331)

Cat. No.: pGMAP-SPh-257
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BNIP3L/BNIP3a/NIX adenoviral expression plasmid for BNIP3L adenovirus packaging, BNIP3L adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to BNIP3L/BNIP3a products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-SPh-257
Gene Name BNIP3L
Accession Number NM_004331
Gene ID 665
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 660 bp
Gene Alias BNIP3a,NIX
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGTCCCACCTAGTCGAGCCGCCGCCGCCCCTGCACAACAACAACAACAACTGCGAGGAAAATGAGCAGTCTCTGCCCCCGCCGGCCGGCCTCAACAGTTCCTGGGTGGAGCTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGAAGAAAGGGGGTATTTTCTCCGCAGAATTTCTGAAGGTGTTCATTCCATCTCTCTTCCTTTCTCATGTTTTGGCTTTGGGGCTAGGCATCTATATTGGAAAGCGACTGAGCACACCCTCTGCCAGCACCTACTGA
ORF Protein Sequence MSSHLVEPPPPLHNNNNNCEENEQSLPPPAGLNSSWVELPMNSSNGNDNGNGKNGGLEHVPSSSSIHNGDMEKILLDAQHESGQSSSRGSSHCDSPSPQEDGQIMFDVEMHTSRDHSSQSEEEVVEGEKEVEALKKSADWVSDWSSRPENIPPKEFHFRHPKRSVSLSMRKSGAMKKGGIFSAEFLKVFIPSLFLSHVLALGLGIYIGKRLSTPSASTY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0427-Ab Anti-BNIP3L monoclonal antibody
    Target Antigen GM-Tg-g-IP0427-Ag BNIP3L protein
    ORF Viral Vector pGMLP000351 Human BNIP3L Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-117 Human BNIP3L Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-257 Human BNIP3L Adenovirus plasmid
    ORF Viral Vector pGMPC000336 Human BNIP3L Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000351 Human BNIP3L Lentivirus particle
    ORF Viral Vector vGMLP-SPh-117 Human BNIP3L Lentivirus particle
    ORF Viral Vector vGMAP-SPh-257 Human BNIP3L Adenovirus particle


    Target information

    Target ID GM-IP0427
    Target Name BNIP3L
    Gene Group Identifier
    （Target Gene ID in Homo species)         		665
    Gene ID 100054317 (Equus caballus), 101099293 (Felis catus), 12177 (Mus musculus), 140923 (Rattus norvegicus)
    534615 (Bos taurus), 608552 (Canis lupus familiaris), 641440 (Macaca mulatta), 665 (Homo sapiens)
    Gene Symbols & Synonyms BNIP3L,Bnip3l,Nix,Nip3L,D14Ertd719e,UV93,NIX,NIP3L,BNIP3a
    Target Alternative Names BNIP3L,BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like,Adenovirus E1B19K-binding protein B5, BCL2/adenovirus E1B 19 kDa protein-interacting protein 3A, NIP3-like protein X (NIP3L),NIX,NIP3L,BNIP3a
    Uniprot Accession O60238,Q3T013,Q9Z2F7
    Additional SwissProt Accessions: Q9Z2F7,Q3T013,O60238
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000005770, ENSMUSG00000022051, ENSBTAG00000021307, ENSMMUG00000023646, ENSG00000104765
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.