Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human IGFBP2/IBP2/IGF-BP53 ORF/cDNA clone-Lentivirus particle (NM_000597.3)
Cat. No.: vGMLV002545
Pre-made Human IGFBP2/IBP2/IGF-BP53 Lentiviral expression plasmid for IGFBP2 lentivirus packaging, IGFBP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IGFBP2/IBP2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV002545 | Human IGFBP2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV002545 |
| Gene Name | IGFBP2 |
| Accession Number | NM_000597.3 |
| Gene ID | 3485 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 978 bp |
| Gene Alias | IBP2,IGF-BP53 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTGCCGAGAGTGGGCTGCCCCGCGCTGCCGCTGCCGCCGCCGCCGCTGCTGCCGCTGCTGCTGCTGCTACTGGGCGCGAGTGGCGGCGGCGGCGGGGCGCGCGCGGAGGTGCTGTTCCGCTGCCCGCCCTGCACACCCGAGCGCCTGGCCGCCTGCGGGCCCCCGCCGGTTGCGCCGCCCGCCGCGGTGGCCGCAGTGGCCGGAGGCGCCCGCATGCCATGCGCGGAGCTCGTCCGGGAGCCGGGCTGCGGCTGCTGCTCGGTGTGCGCCCGGCTGGAGGGCGAGGCGTGCGGCGTCTACACCCCGCGCTGCGGCCAGGGGCTGCGCTGCTATCCCCACCCGGGCTCCGAGCTGCCCCTGCAGGCGCTGGTCATGGGCGAGGGCACTTGTGAGAAGCGCCGGGACGCCGAGTATGGCGCCAGCCCGGAGCAGGTTGCAGACAATGGCGATGACCACTCAGAAGGAGGCCTGGTGGAGAACCACGTGGACAGCACCATGAACATGTTGGGCGGGGGAGGCAGTGCTGGCCGGAAGCCCCTCAAGTCGGGTATGAAGGAGCTGGCCGTGTTCCGGGAGAAGGTCACTGAGCAGCACCGGCAGATGGGCAAGGGTGGCAAGCATCACCTTGGCCTGGAGGAGCCCAAGAAGCTGCGACCACCCCCTGCCAGGACTCCCTGCCAACAGGAACTGGACCAGGTCCTGGAGCGGATCTCCACCATGCGCCTTCCGGATGAGCGGGGCCCTCTGGAGCACCTCTACTCCCTGCACATCCCCAACTGTGACAAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAG |
| ORF Protein Sequence | MLPRVGCPALPLPPPPLLPLLLLLLGASGGGGGARAEVLFRCPPCTPERLAACGPPPVAPPAAVAAVAGGARMPCAELVREPGCGCCSVCARLEGEACGVYTPRCGQGLRCYPHPGSELPLQALVMGEGTCEKRRDAEYGASPEQVADNGDDHSEGGLVENHVDSTMNMLGGGGSAGRKPLKSGMKELAVFREKVTEQHRQMGKGGKHHLGLEEPKKLRPPPARTPCQQELDQVLERISTMRLPDERGPLEHLYSLHIPNCDKHGLYNLKQCKMSLNGQRGECWCVNPNTGKLIQGAPTIRGDPECHLFYNEQQEARGVHTQRMQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T64268-Ab | Anti-IBP2/ IGFBP2/ IGF-BP53 functional antibody |
| Target Antigen | GM-Tg-g-T64268-Ag | IGFBP2 protein |
| Cytokine | cks-Tg-g-GM-T64268 | insulin-like growth factor binding protein 2, 36kDa (IGFBP2) protein & antibody |
| ORF Viral Vector | pGMLP004595 | Human IGFBP2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002545 | Human IGFBP2 Lentivirus plasmid |
| ORF Viral Vector | pGMPC001682 | Human IGFBP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP004595 | Human IGFBP2 Lentivirus particle |
| ORF Viral Vector | vGMLV002545 | Human IGFBP2 Lentivirus particle |
Target information
| Target ID | GM-T64268 |
| Target Name | IGFBP2 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3485 |
| Gene ID |
100034061 (Equus caballus), 101088426 (Felis catus), 16008 (Mus musculus), 25662 (Rattus norvegicus) 282260 (Bos taurus), 3485 (Homo sapiens), 488516 (Canis lupus familiaris), 696214 (Macaca mulatta) |
| Gene Symbols & Synonyms | IGFBP2,Igfbp2,IGFBP-2,IBP-2,Igfbp-2,mIGFBP-2,BRL-BP,ILGFBPA,IBP2,IGF-BP53 |
| Target Alternative Names | BRL-BP,IBP-2,IBP2,IGF-BP53,IGF-binding protein 2,IGFBP-2,IGFBP2,ILGFBPA,Igfbp-2,Igfbp2,Insulin-like growth factor-binding protein 2,mIGFBP-2 |
| Uniprot Accession |
P12843,P13384,P18065,P47877
Additional SwissProt Accessions: P47877,P12843,P13384,P18065 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | cancer, Ovary Cancer, Dent disease |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000035279, ENSMUSG00000039323, ENSBTAG00000005596, ENSG00000115457, ENSCAFG00845024863, ENSMMUG00000054183 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.