Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human CLDN1/CLD1/ILVASC ORF/cDNA clone-Lentivirus particle (NM_021101.5)
Cat. No.: vGMLV001928
Pre-made Human CLDN1/CLD1/ILVASC Lentiviral expression plasmid for CLDN1 lentivirus packaging, CLDN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
Claudin 1/CLDN1/CLDN1/CLD1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001928 | Human CLDN1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001928 |
| Gene Name | CLDN1 |
| Accession Number | NM_021101.5 |
| Gene ID | 9076 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 636 bp |
| Gene Alias | CLD1,ILVASC,SEMP1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCAACGCGGGGCTGCAGCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCGGCGCCATCGTCAGCACTGCCCTGCCCCAGTGGAGGATTTACTCCTATGCCGGCGACAACATCGTGACCGCCCAGGCCATGTACGAGGGGCTGTGGATGTCCTGCGTGTCGCAGAGCACCGGGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAACCTGCACCTTCCAGCGGGAAAGACTACGTGTGA |
| ORF Protein Sequence | MANAGLQLLGFILAFLGWIGAIVSTALPQWRIYSYAGDNIVTAQAMYEGLWMSCVSQSTGQIQCKVFDSLLNLSSTLQATRALMVVGILLGVIAIFVATVGMKCMKCLEDDEVQKMRMAVIGGAIFLLAGLAILVATAWYGNRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTTSYPTPRPYPKPAPSSGKDYV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0271-Ab | Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0271-Ag | CLDN1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLV000077 | Human CLDN1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001928 | Human CLDN1 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000975 | Human CLDN1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000077 | Human CLDN1 Lentivirus particle |
| ORF Viral Vector | vGMLV001928 | Human CLDN1 Lentivirus particle |
Target information
| Target ID | GM-MP0271 |
| Target Name | Claudin 1/CLDN1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
9076 |
| Gene ID |
100059811 (Equus caballus), 101094619 (Felis catus), 12737 (Mus musculus), 414922 (Bos taurus) 608207 (Canis lupus familiaris), 65129 (Rattus norvegicus), 704330 (Macaca mulatta), 9076 (Homo sapiens) |
| Gene Symbols & Synonyms | CLDN1,Cldn1,claudin-1,CLD1,SEMP1,ILVASC |
| Target Alternative Names | CLD1,CLDN1,Claudin 1,Claudin-1,Cldn1,ILVASC,SEMP1,Senescence-associated epithelial membrane protein,claudin-1 |
| Uniprot Accession |
O88551,O95832,P56745,Q6L708
Additional SwissProt Accessions: O88551,Q6L708,P56745,O95832 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | |
| Disease | cancer |
| Disease from KEGG | Cell adhesion molecules, Tight junction, Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Hepatitis C |
| Gene Ensembl | ENSECAG00000021074, ENSMUSG00000022512, ENSBTAG00000013148, ENSCAFG00845024289, ENSMMUG00000001915, ENSG00000163347 |
| Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.