Human SNAP25/bA416N4.2/CMS18 ORF/cDNA clone-Lentivirus particle (NM_003081)

Cat. No.: vGMLV001735

Pre-made Human SNAP25/bA416N4.2/CMS18 Lentiviral expression plasmid for SNAP25 lentivirus packaging, SNAP25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SNAP25/bA416N4.2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001735 Human SNAP25 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001735
Gene Name SNAP25
Accession Number NM_003081
Gene ID 6616
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 621 bp
Gene Alias bA416N4.2,CMS18,dJ1068F16.2,RIC-4,RIC4,SEC9,SNAP,SNAP-25,SUP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGATTTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTAGTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGGAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA
ORF Protein Sequence MAEDADMRNELEEMQRRADQLADESLESTRRMLQLVEESKDAGIRTLVMLDEQGEQLDRVEEGMNHINQDMKEAEKNLKDLGKCCGLFICPCNKLKSSDAYKKAWGNNQDGVVASQPARVVDEREQMAISGGFIRRVTNDARENEMDENLEQVSGIIGNLRHMALDMGNEIDTQNRQIDRIMEKADSNKTRIDEANQRATKMLGSG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T71023-Ab Anti-SNP25/ SNAP25/ CMS18 monoclonal antibody
    Target Antigen GM-Tg-g-T71023-Ag SNAP25 VLP (virus-like particle)
    ORF Viral Vector pGMLP004868 Human SNAP25 Lentivirus plasmid
    ORF Viral Vector pGMLV001735 Human SNAP25 Lentivirus plasmid
    ORF Viral Vector vGMLP004868 Human SNAP25 Lentivirus particle
    ORF Viral Vector vGMLV001735 Human SNAP25 Lentivirus particle


    Target information

    Target ID GM-T71023
    Target Name SNAP25
    Gene Group Identifier
    （Target Gene ID in Homo species)         		6616
    Gene ID 100051273 (Equus caballus), 101092511 (Felis catus), 20614 (Mus musculus), 25012 (Rattus norvegicus)
    477158 (Canis lupus familiaris), 540853 (Bos taurus), 574204 (Macaca mulatta), 6616 (Homo sapiens)
    Gene Symbols & Synonyms SNAP25,Snap25,sp,Bdr,SUP,GENA70,SNAP-25,SNAP-25B,SNAP-25a,RIC4,SEC9,SNAP,CMS18,RIC-4,bA416N4.2,dJ1068F16.2
    Target Alternative Names Bdr,CMS18,GENA70,RIC-4,RIC4,SEC9,SNAP,SNAP-25,SNAP-25B,SNAP-25a,SNAP25,SUP,Snap25,Super protein (SUP),Synaptosomal-associated 25 kDa protein,Synaptosomal-associated protein 25,bA416N4.2,dJ1068F16.2,sp
    Uniprot Accession P60877,P60879,P60880,P60881,Q17QQ3
    Additional SwissProt Accessions: P60879,P60881,Q17QQ3,P60877,P60880
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Insulin secretion
    Gene Ensembl ENSECAG00000023077, ENSMUSG00000027273, ENSCAFG00845024602, ENSBTAG00000008323, ENSMMUG00000011064, ENSG00000132639
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.