Human CDKN1A/CAP20/CDKN1 ORF/cDNA clone-Lentivirus particle (NM_000389.5)
Cat. No.: vGMLV001624
Pre-made Human CDKN1A/CAP20/CDKN1 Lentiviral expression plasmid for CDKN1A lentivirus packaging, CDKN1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
P21/CDKN1A/CDKN1A/CAP20 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001624 | Human CDKN1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001624 |
| Gene Name | CDKN1A |
| Accession Number | NM_000389.5 |
| Gene ID | 1026 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 495 bp |
| Gene Alias | CAP20,CDKN1,CIP1,MDA-6,P21,p21CIP1,SDI1,WAF1 |
| Fluorescent Reporter | mCherry |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGCTGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAA |
| ORF Protein Sequence | MSEPAGDVRQNPCGSKACRRLFGPVDSEQLSRDCDALMAGCIQEARERWNFDFVTETPLEGDFAWERVRGLGLPKLYLPTGPRRGRDELGGGRRPGTSPALLQGTAEEDHVDLSLSCTLVPRSGEQAEGSPGGPGDSQGRKRRQTSMTDFYHSKRRLIFSKRKP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T39855-Ab | Anti-CDKN1A monoclonal antibody |
| Target Antigen | GM-Tg-g-T39855-Ag | CDKN1A protein |
| ORF Viral Vector | pGMLV001624 | Human CDKN1A Lentivirus plasmid |
| ORF Viral Vector | pGMAP000096 | Human CDKN1A Adenovirus plasmid |
| ORF Viral Vector | pGMPC000071 | Human CDKN1A Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV001624 | Human CDKN1A Lentivirus particle |
| ORF Viral Vector | vGMAP000096 | Human CDKN1A Adenovirus particle |
Target information
| Target ID | GM-T39855 |
| Target Name | P21/CDKN1A |
|
Gene Group Identifier (Target Gene ID in Homo species) |
1026 |
| Gene ID |
100064022 (Equus caballus), 1026 (Homo sapiens), 114851 (Rattus norvegicus), 12575 (Mus musculus) 474890 (Canis lupus familiaris), 493943 (Felis catus), 513497 (Bos taurus), 719199 (Macaca mulatta) |
| Gene Symbols & Synonyms | CDKN1A,Cdkn1a,P21,CIP1,SDI1,WAF1,CAP20,CDKN1,MDA-6,p21CIP1,Cip1,UV96,Waf1,CDKI,mda6,Cdkn1,p21WAF,p21Cip1,p21 |
| Target Alternative Names | CAP20,CDK-interacting protein 1,CDKI,CDKN1,CDKN1A,CIP1,Cdkn1,Cdkn1a,Cip1,Cyclin-dependent kinase inhibitor 1,MDA-6,Melanoma differentiation-associated protein 6 (MDA-6),P21,SDI1,UV96,WAF1,Waf1,mda6,p21,p21CIP1,p21Cip1,p21WAF |
| Uniprot Accession |
O19002,P38936,P39689
Additional SwissProt Accessions: P38936,P39689,O19002 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer, Prostate Cancer |
| Disease from KEGG | Endocrine resistance, ErbB signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Cellular senescence, JAK-STAT signaling pathway, Oxytocin signaling pathway, Parathyroid hormone synthesis, secretion and action, Cushing syndrome, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Basal cell carcinoma, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer |
| Gene Ensembl | ENSG00000124762, ENSMUSG00000023067, ENSBTAG00000008353, ENSMMUG00000055964 |
| Target Classification | Kinase |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


