Human CDKN1A/CAP20/CDKN1 ORF/cDNA clone-Lentivirus particle (NM_000389.5)

Cat. No.: vGMLV001624

Pre-made Human CDKN1A/CAP20/CDKN1 Lentiviral expression plasmid for CDKN1A lentivirus packaging, CDKN1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to P21/CDKN1A/CDKN1A/CAP20 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001624 Human CDKN1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001624
Gene Name CDKN1A
Accession Number NM_000389.5
Gene ID 1026
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 495 bp
Gene Alias CAP20,CDKN1,CIP1,MDA-6,P21,p21CIP1,SDI1,WAF1
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGCTGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAA
ORF Protein Sequence MSEPAGDVRQNPCGSKACRRLFGPVDSEQLSRDCDALMAGCIQEARERWNFDFVTETPLEGDFAWERVRGLGLPKLYLPTGPRRGRDELGGGRRPGTSPALLQGTAEEDHVDLSLSCTLVPRSGEQAEGSPGGPGDSQGRKRRQTSMTDFYHSKRRLIFSKRKP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39855-Ab Anti-CDKN1A monoclonal antibody
    Target Antigen GM-Tg-g-T39855-Ag CDKN1A protein
    ORF Viral Vector pGMLV001624 Human CDKN1A Lentivirus plasmid
    ORF Viral Vector pGMAP000096 Human CDKN1A Adenovirus plasmid
    ORF Viral Vector pGMPC000071 Human CDKN1A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001624 Human CDKN1A Lentivirus particle
    ORF Viral Vector vGMAP000096 Human CDKN1A Adenovirus particle


    Target information

    Target ID GM-T39855
    Target Name P21/CDKN1A
    Gene Group Identifier
    (Target Gene ID in Homo species)
    1026
    Gene ID 100064022 (Equus caballus), 1026 (Homo sapiens), 114851 (Rattus norvegicus), 12575 (Mus musculus)
    474890 (Canis lupus familiaris), 493943 (Felis catus), 513497 (Bos taurus), 719199 (Macaca mulatta)
    Gene Symbols & Synonyms CDKN1A,Cdkn1a,P21,CIP1,SDI1,WAF1,CAP20,CDKN1,MDA-6,p21CIP1,Cip1,UV96,Waf1,CDKI,mda6,Cdkn1,p21WAF,p21Cip1,p21
    Target Alternative Names CAP20,CDK-interacting protein 1,CDKI,CDKN1,CDKN1A,CIP1,Cdkn1,Cdkn1a,Cip1,Cyclin-dependent kinase inhibitor 1,MDA-6,Melanoma differentiation-associated protein 6 (MDA-6),P21,SDI1,UV96,WAF1,Waf1,mda6,p21,p21CIP1,p21Cip1,p21WAF
    Uniprot Accession O19002,P38936,P39689
    Additional SwissProt Accessions: P38936,P39689,O19002
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer, Prostate Cancer
    Disease from KEGG Endocrine resistance, ErbB signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Cellular senescence, JAK-STAT signaling pathway, Oxytocin signaling pathway, Parathyroid hormone synthesis, secretion and action, Cushing syndrome, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Basal cell carcinoma, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSG00000124762, ENSMUSG00000023067, ENSBTAG00000008353, ENSMMUG00000055964
    Target Classification Kinase


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.