Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human LCN2/24p3/MSFI ORF/cDNA clone-Lentivirus particle (NM_005564)
Cat. No.: vGMLV001321
Pre-made Human LCN2/24p3/MSFI Lentiviral expression plasmid for LCN2 lentivirus packaging, LCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
NGAL/LCN2/LCN2/24p3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001321 | Human LCN2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001321 |
| Gene Name | LCN2 |
| Accession Number | NM_005564 |
| Gene ID | 3934 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 597 bp |
| Gene Alias | 24p3,MSFI,NGAL,p25 |
| Fluorescent Reporter | Firefly luciferase |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCCCTAGGTCTCCTGTGGCTGGGCCTAGCCCTGTTGGGGGCTCTGCATGCCCAGGCCCAGGACTCCACCTCAGACCTGATCCCAGCCCCACCTCTGAGCAAGGTCCCTCTGCAGCAGAACTTCCAGGACAACCAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTCCCAATCGACCAGTGTATCGACGGCTGA |
| ORF Protein Sequence | MPLGLLWLGLALLGALHAQAQDSTSDLIPAPPLSKVPLQQNFQDNQFQGKWYVVGLAGNAILREDKDPQKMYATIYELKEDKSYNVTSVLFRKKKCDYWIRTFVPGCQPGEFTLGNIKSYPGLTSYLVRVVSTNYNQHAMVFFKKVSQNREYFKITLYGRTKELTSELKENFIRFSKSLGLPENHIVFPVPIDQCIDG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T72010-Ab | Anti-NGAL/ LCN2/ 24p3 functional antibody |
| Target Antigen | GM-Tg-g-T72010-Ag | LCN2 protein |
| ORF Viral Vector | pGMLP002859 | Human LCN2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001321 | Human LCN2 Lentivirus plasmid |
| ORF Viral Vector | pGMAD001066 | Human LCN2 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000637 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC000792 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001300 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001766 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP002859 | Human LCN2 Lentivirus particle |
| ORF Viral Vector | vGMLV001321 | Human LCN2 Lentivirus particle |
| ORF Viral Vector | vGMAD001066 | Human LCN2 Adenovirus particle |
Target information
| Target ID | GM-T72010 |
| Target Name | NGAL/LCN2 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3934 |
| Gene ID |
100070310 (Equus caballus), 16819 (Mus musculus), 170496 (Rattus norvegicus), 3934 (Homo sapiens) 491320 (Canis lupus familiaris), 526639 (Bos taurus), 697208 (Macaca mulatta) |
| Gene Symbols & Synonyms | LCN2,Lcn2,NRL,24p3,Sip24,p25,MSFI,NGAL |
| Target Alternative Names | 24p3,25 kDa alpha-2-microglobulin-related subunit of MMP-9,LCN2,Lcn2,Lipocalin-2,MSFI,NGAL,NRL,Neutrophil gelatinase-associated lipocalin,Oncogene 24p3,Siderocalin,Sip24,p25 |
| Uniprot Accession |
P11672,P30152,P80188
Additional SwissProt Accessions: P11672,P30152,P80188 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | cancer, Prostate Cancer, Complications of kidney transplant, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to hazardous aromatic compounds, Contrast - Induced Nephropathy, Delayed Graft Function, Dent disease, Diabetic Nephropathy, HIV-Associated Nephropathy, Hydronephrosis, Hypertension, Impaired renal function disease, Injury to Kidney, Intraoperative Renal Injury, Kidney transplant rejection, Lupus Glomerulonephritis, Neonatal urinary tract infection, Nephrectomy, Nephropathy induced by other drugs, medicaments and biological substances, Nephrotic syndrome, Nephrotic syndrome with diffuse membranous glomerulonephritis, Proteinuria, Renal fibrosis, Renovascular hypertension, Sepsis due to Enterococcus, Systemic inflammatory response syndrome (SIRS) of non-infectious origin with acute organ dysfunction, Systemic lupus erythematosus (SLE), Transplanted Heart Complication, Type 1 diabetes mellitus with diabetic nephropathy, Acute pancreatitis, Asphyxia neonatorum, Autosomal Dominant Polycystic Kidney Disease, Cardiogenic shock, Chronic Kidney Disease, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux |
| Disease from KEGG | IL-17 signaling pathway |
| Gene Ensembl | ENSECAG00000020957, ENSMUSG00000026822, ENSG00000148346, ENSCAFG00845029755, ENSBTAG00000014149, ENSMMUG00000023801 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.