Human VSIR/B7-H5/B7H5 ORF/cDNA clone-Lentivirus particle (NM_022153.1)
Cat. No.: vGMLV000879
Pre-made Human VSIR/B7-H5/B7H5 Lentiviral expression plasmid for VSIR lentivirus packaging, VSIR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
VISTA/VSIR/VSIR/B7-H5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000879 | Human VSIR Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000879 |
Gene Name | VSIR |
Accession Number | NM_022153.1 |
Gene ID | 64115 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 936 bp |
Gene Alias | B7-H5,B7H5,C10orf54,DD1alpha,GI24,PD-1H,PP2135,SISP1,VISTA |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGCGTCCCCACGGCCCTGGAGGCCGGCAGCTGGCGCTGGGGATCCCTGCTCTTCGCTCTCTTCCTGGCTGCGTCCCTAGGTCCGGTGGCAGCCTTCAAGGTCGCCACGCCGTATTCCCTGTATGTCTGTCCCGAGGGGCAGAACGTCACCCTCACCTGCAGGCTCTTGGGCCCTGTGGACAAAGGGCACGATGTGACCTTCTACAAGACGTGGTACCGCAGCTCGAGGGGCGAGGTGCAGACCTGCTCAGAGCGCCGGCCCATCCGCAACCTCACGTTCCAGGACCTTCACCTGCACCATGGAGGCCACCAGGCTGCCAACACCAGCCACGACCTGGCTCAGCGCCACGGGCTGGAGTCGGCCTCCGACCACCATGGCAACTTCTCCATCACCATGCGCAACCTGACCCTGCTGGATAGCGGCCTCTACTGCTGCCTGGTGGTGGAGATCAGGCACCACCACTCGGAGCACAGGGTCCATGGTGCCATGGAGCTGCAGGTGCAGACAGGCAAAGATGCACCATCCAACTGTGTGGTGTACCCATCCTCCTCCCAGGATAGTGAAAACATCACGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCCTCCAACCGCCGTGCCCAGGAGCTGGTGCGGATGGACAGCAACATTCAAGGGATTGAAAACCCCGGCTTTGAAGCCTCACCACCTGCCCAGGGGATACCCGAGGCCAAAGTCAGGCACCCCCTGTCCTATGTGGCCCAGCGGCAGCCTTCTGAGTCTGGGCGGCATCTGCTTTCGGAGCCCAGCACCCCCCTGTCTCCTCCAGGCCCCGGAGACGTCTTCTTCCCATCCCTGGACCCTGTCCCTGACTCTCCAAACTTTGAGGTCATCTAG |
ORF Protein Sequence | MGVPTALEAGSWRWGSLLFALFLAASLGPVAAFKVATPYSLYVCPEGQNVTLTCRLLGPVDKGHDVTFYKTWYRSSRGEVQTCSERRPIRNLTFQDLHLHHGGHQAANTSHDLAQRHGLESASDHHGNFSITMRNLTLLDSGLYCCLVVEIRHHHSEHRVHGAMELQVQTGKDAPSNCVVYPSSSQDSENITAAALATGACIVGILCLPLILLLVYKQRQAASNRRAQELVRMDSNIQGIENPGFEASPPAQGIPEAKVRHPLSYVAQRQPSESGRHLLSEPSTPLSPPGPGDVFFPSLDPVPDSPNFEVI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-406 | Pre-Made Onvatilimab biosimilar, Whole mAb, Anti-VSIR Antibody: Anti-B7-H5/B7H5/C10orf54/DD1alpha/Dies1/GI24/PD-1H/PP2135/SISP1/VISTA therapeutic antibody |
Target Antibody | GM-Tg-g-T99704-Ab | Anti-VISTA/ VSIR/ B7-H5 monoclonal antibody |
Target Antigen | GM-Tg-g-T99704-Ag | VSIR VLP (virus-like particle) |
ORF Viral Vector | pGMLP004294 | Human VSIR Lentivirus plasmid |
ORF Viral Vector | pGMLV000879 | Human VSIR Lentivirus plasmid |
ORF Viral Vector | pGMLV000880 | Human VSIR Lentivirus plasmid |
ORF Viral Vector | vGMLP004294 | Human VSIR Lentivirus particle |
ORF Viral Vector | vGMLV000879 | Human VSIR Lentivirus particle |
ORF Viral Vector | vGMLV000880 | Human VSIR Lentivirus particle |
Target information
Target ID | GM-T99704 |
Target Name | VISTA/VSIR |
Gene Group Identifier (Target Gene ID in Homo species) |
64115 |
Gene ID |
101096355 (Felis catus), 102149832 (Equus caballus), 106558705 (Canis lupus familiaris), 64115 (Homo sapiens) 690899 (Rattus norvegicus), 709595 (Macaca mulatta), 74048 (Mus musculus), 783068 (Bos taurus) |
Gene Symbols & Synonyms | VSIR,Vsir,CD2H10orf54,C1H10orf54,C4H10orf54,B7H5,GI24,B7-H5,Dies1,PD-1H,SISP1,VISTA,PP2135,C10orf54,DD1alpha,C9orf54,C9H10orf54,4632428N05Rik,C28H10orf54 |
Target Alternative Names | 4632428N05Rik,B7-H5,B7H5,C10orf54,C1H10orf54,C28H10orf54,C4H10orf54,C9H10orf54,C9orf54,CD2H10orf54,DD1alpha,Dies1,GI24,PD-1H,PP2135,Platelet receptor Gi24,SISP1,Stress-induced secreted protein-1 (Sisp-1),V-set domain-containing immunoregulatory receptor,V-set immunoregulatory receptor,V-type immunoglobulin domain-containing suppressor of T-cell activation,VISTA,VSIR,Vsir |
Uniprot Accession |
Q9D659,Q9H7M9
Additional SwissProt Accessions: Q9H7M9,Q9D659 |
Uniprot Entry Name | |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | |
Disease from KEGG | Cell adhesion molecules |
Gene Ensembl | ENSECAG00000018133, ENSCAFG00845004580, ENSG00000107738, ENSMMUG00000012967, ENSMUSG00000020101, ENSBTAG00000010888 |
Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.