Human TINAGL1/ARG1/LCN7 ORF/cDNA clone-Lentivirus particle (NM_022164)

Cat. No.: vGMLV000543

Pre-made Human TINAGL1/ARG1/LCN7 Lentiviral expression plasmid for TINAGL1 lentivirus packaging, TINAGL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TINAGL1/ARG1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000543 Human TINAGL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000543
Gene Name TINAGL1
Accession Number NM_022164
Gene ID 64129
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1404 bp
Gene Alias ARG1,LCN7,LIECG3,TINAGRP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCGATGTCCACTGGGGCTACTGCTGTTGCTGCCGCTGGCTGGCCACTTGGCTCTGGGTGCCCAGCAGGGTCGTGGGCGCCGGGAGCTAGCACCGGGTCTGCACCTGCGGGGCATCCGGGACGCGGGAGGCCGGTACTGCCAGGAGCAGGACCTGTGCTGCCGCGGCCGTGCCGACGACTGTGCCCTGCCCTACCTGGGCGCCATCTGTTACTGTGACCTCTTCTGCAACCGCACGGTCTCCGACTGCTGCCCTGACTTCTGGGACTTCTGCCTCGGCGTGCCACCCCCTTTTCCCCCGATCCAAGGATGTATGCATGGAGGTCGTATCTATCCAGTCTTGGGAACGTACTGGGACAACTGTAACCGTTGCACCTGCCAGGAGAACAGGCAGTGGCAGTGTGACCAAGAACCATGCCTGGTGGATCCAGACATGATCAAAGCCATCAACCAGGGCAACTATGGCTGGCAGGCTGGGAACCACAGCGCCTTCTGGGGCATGACCCTGGATGAGGGCATTCGCTACCGCCTGGGCACCATCCGCCCATCTTCCTCGGTCATGAACATGCATGAAATTTATACAGTGCTGAACCCAGGGGAGGTGCTTCCCACAGCCTTCGAGGCCTCTGAGAAGTGGCCCAACCTGATTCATGAGCCTCTTGACCAAGGCAACTGTGCAGGCTCCTGGGCCTTCTCCACAGCAGCTGTGGCATCCGATCGTGTCTCAATCCATTCTCTGGGACACATGACGCCTGTCCTGTCGCCCCAGAACCTGCTGTCTTGTGACACCCACCAGCAGCAGGGCTGCCGCGGTGGGCGTCTCGATGGTGCCTGGTGGTTCCTGCGTCGCCGAGGGGTGGTGTCTGACCACTGCTACCCCTTCTCGGGCCGTGAACGAGACGAGGCTGGCCCTGCGCCCCCCTGTATGATGCACAGCCGAGCCATGGGTCGGGGCAAGCGCCAGGCCACTGCCCACTGCCCCAACAGCTATGTTAATAACAATGACATCTACCAGGTCACTCCTGTCTACCGCCTCGGCTCCAACGACAAGGAGATCATGAAGGAGCTGATGGAGAATGGCCCTGTCCAAGCCCTCATGGAGGTGCATGAGGACTTCTTCCTATACAAGGGAGGCATCTACAGCCACACGCCAGTGAGCCTTGGGAGGCCAGAGAGATACCGCCGGCATGGGACCCACTCAGTCAAGATCACAGGATGGGGAGAGGAGACGCTGCCAGATGGAAGGACGCTCAAATACTGGACTGCGGCCAACTCCTGGGGCCCAGCCTGGGGCGAGAGGGGCCACTTCCGCATCGTGCGCGGCGTCAATGAGTGCGACATCGAGAGCTTCGTGCTGGGCGTCTGGGGCCGCGTGGGCATGGAGGACATGGGTCATCACTGA
ORF Protein Sequence MWRCPLGLLLLLPLAGHLALGAQQGRGRRELAPGLHLRGIRDAGGRYCQEQDLCCRGRADDCALPYLGAICYCDLFCNRTVSDCCPDFWDFCLGVPPPFPPIQGCMHGGRIYPVLGTYWDNCNRCTCQENRQWQCDQEPCLVDPDMIKAINQGNYGWQAGNHSAFWGMTLDEGIRYRLGTIRPSSSVMNMHEIYTVLNPGEVLPTAFEASEKWPNLIHEPLDQGNCAGSWAFSTAAVASDRVSIHSLGHMTPVLSPQNLLSCDTHQQQGCRGGRLDGAWWFLRRRGVVSDHCYPFSGRERDEAGPAPPCMMHSRAMGRGKRQATAHCPNSYVNNNDIYQVTPVYRLGSNDKEIMKELMENGPVQALMEVHEDFFLYKGGIYSHTPVSLGRPERYRRHGTHSVKITGWGEETLPDGRTLKYWTAANSWGPAWGERGHFRIVRGVNECDIESFVLGVWGRVGMEDMGHH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1342-Ab Anti-TINAL/ TINAGL1/ ARG1 functional antibody
    Target Antigen GM-Tg-g-SE1342-Ag TINAGL1 protein
    ORF Viral Vector pGMLP003135 Human TINAGL1 Lentivirus plasmid
    ORF Viral Vector pGMLV000066 Human TINAGL1 Lentivirus plasmid
    ORF Viral Vector pGMLV000543 Human TINAGL1 Lentivirus plasmid
    ORF Viral Vector vGMLP003135 Human TINAGL1 Lentivirus particle
    ORF Viral Vector vGMLV000066 Human TINAGL1 Lentivirus particle
    ORF Viral Vector vGMLV000543 Human TINAGL1 Lentivirus particle


    Target information

    Target ID GM-SE1342
    Target Name TINAGL1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		64129
    Gene ID 100056208 (Equus caballus), 101101397 (Felis catus), 478155 (Canis lupus familiaris), 509642 (Bos taurus)
    64129 (Homo sapiens), 705660 (Macaca mulatta), 94174 (Rattus norvegicus), 94242 (Mus musculus)
    Gene Symbols & Synonyms TINAGL1,Tinagl1,ARG1,LCN7,LIECG3,TINAGRP,Lcn7,gis5,AZ1,AZ-1,Arg1,TARP,Tinagl,1110021J17Rik
    Target Alternative Names TINAGL1,Tubulointerstitial nephritis antigen-like,Glucocorticoid-inducible protein 5, Oxidized LDL-responsive gene 2 protein (OLRG-2), Tubulointerstitial nephritis antigen-related protein (TIN Ag-related protein, TIN-Ag-RP),ARG1,LCN7,LIECG3,TINAGRP
    Uniprot Accession Q99JR5,Q9EQT5,Q9GZM7
    Additional SwissProt Accessions: Q9GZM7,Q9EQT5,Q99JR5
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000014247, ENSCAFG00845005917, ENSBTAG00000013235, ENSG00000142910, ENSMUSG00000028776
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.