Human IL34/C16orf77/IL-34 ORF/cDNA clone-Lentivirus particle (NM_001172772.1)

Cat. No.: vGMLV000372

Pre-made Human IL34/C16orf77/IL-34 Lentiviral expression plasmid for IL34 lentivirus packaging, IL34 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IL34/C16orf77 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000372 Human IL34 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000372
Gene Name IL34
Accession Number NM_001172772.1
Gene ID 146433
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 729 bp
Gene Alias C16orf77,IL-34
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTTTGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTACAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGGGTGTTCAGAATCGCCAACGTCACCAGGCTGCAGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGGTCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTACCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAGGTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGCTGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAGCTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGGCACAGGGCGAGGGCCTCTTGCCCTGA
ORF Protein Sequence MPRGFTWLRYLGIFLGVALGNEPLEMWPLTQNEECTVTGFLRDKLQYRSRLQYMKHYFPINYKISVPYEGVFRIANVTRLQRAQVSERELRYLWVLVSLSATESVQDVLLEGHPSWKYLQEVETLLLNVQQGLTDVEVSPKVESVLSLLNAPGPNLKLVRPKALLDNCFRVMELLYCSCCKQSSVLNWQDCEVPSPQSCSPEPSLQYAATQLYPPPPWSPSSPPHSTGSVRPVRAQGEGLLP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1028-Ab Anti-IL34/ C16orf77/ IL-34 functional antibody
    Target Antigen GM-Tg-g-SE1028-Ag IL34 protein
    ORF Viral Vector pGMLV000372 Human IL34 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-038 Human IL34 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-121 Human IL34 Adenovirus plasmid
    ORF Viral Vector pGMPC000680 Human IL34 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000372 Human IL34 Lentivirus particle
    ORF Viral Vector vGMLP-IL-038 Human IL34 Lentivirus particle
    ORF Viral Vector vGMAP-IL-121 Human IL34 Adenovirus particle


    Target information

    Target ID GM-SE1028
    Target Name IL34
    Gene Group Identifier
    (Target Gene ID in Homo species)
    146433
    Gene ID 100054703 (Equus caballus), 101094391 (Felis catus), 146433 (Homo sapiens), 498951 (Rattus norvegicus)
    508292 (Bos taurus), 610536 (Canis lupus familiaris), 709034 (Macaca mulatta), 76527 (Mus musculus)
    Gene Symbols & Synonyms IL34,Il34,IL-34,C16orf77,C18H16ORF77,2010004A03Rik
    Target Alternative Names 2010004A03Rik,C16orf77,C18H16ORF77,IL-34,IL34,Il34,Interleukin-34
    Uniprot Accession A6QL48,Q4KM46,Q6ZMJ4,Q8R1R4
    Additional SwissProt Accessions: Q6ZMJ4,Q4KM46,A6QL48,Q8R1R4
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor
    Gene Ensembl ENSECAG00000012327, ENSG00000157368, ENSBTAG00000009357, ENSCAFG00845005263, ENSMMUG00000020415, ENSMUSG00000031750
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.