Human FTH1/FHC/FTH ORF/cDNA clone-Lentivirus particle (NM_002032)
Cat. No.: vGMLV000308
Pre-made Human FTH1/FHC/FTH Lentiviral expression plasmid for FTH1 lentivirus packaging, FTH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
Ferritin heavy chain/FTH1/FTH1/FHC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000308 | Human FTH1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000308 |
Gene Name | FTH1 |
Accession Number | NM_002032 |
Gene ID | 2495 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 552 bp |
Gene Alias | FHC,FTH,FTHL6,HFE5,PIG15,PLIF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA |
ORF Protein Sequence | MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89873-Ab | Anti-FTH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T89873-Ag | FTH1 protein |
ORF Viral Vector | pGMLV000307 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000308 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000151 | Human FTH1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000822 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001052 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000307 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMLV000308 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMAP000151 | Human FTH1 Adenovirus particle |
Target information
Target ID | GM-T89873 |
Target Name | Ferritin heavy chain/FTH1 |
Gene Group Identifier (Target Gene ID in Homo species) |
2495 |
Gene ID |
100062811 (Equus caballus), 14319 (Mus musculus), 2495 (Homo sapiens), 25319 (Rattus norvegicus) 281173 (Bos taurus), 403631 (Canis lupus familiaris), 574118 (Macaca mulatta), 654516 (Felis catus) |
Gene Symbols & Synonyms | FTH1,Fth1,FHC,Fth,HFt,MFH,FTH,HFE5,PLIF,FTHL6,NBIA9,PIG15 |
Target Alternative Names | Cell proliferation-inducing gene 15 protein,FHC,FTH,FTH1,FTHL6,Ferritin H subunit,Ferritin heavy chain,Fth,Fth1,HFE5,HFt,MFH,NBIA9,PIG15,PLIF |
Uniprot Accession |
O46414,P02794,P09528,P19132,Q2MHN2,Q8MIP0,Q95MP7
Additional SwissProt Accessions: Q8MIP0,P09528,P02794,P19132,O46414,Q95MP7,Q2MHN2 |
Uniprot Entry Name | |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | |
Disease from KEGG | Ferroptosis, Mineral absorption |
Gene Ensembl | ENSECAG00000008683, ENSMUSG00000024661, ENSG00000167996, ENSBTAG00000011184, ENSCAFG00845010380, ENSMMUG00000015146 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.