Human CAPS/CAPS1 ORF/cDNA clone-Lentivirus particle (NM_004058.4)

Cat. No.: vGMLV000249

Pre-made Human CAPS/CAPS1 Lentiviral expression plasmid for CAPS lentivirus packaging, CAPS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to calcyphosine/Calcyphosine/CAPS/CAPS/CAPS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000249 Human CAPS Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000249
Gene Name CAPS
Accession Number NM_004058.4
Gene ID 828
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 828 bp
Gene Alias CAPS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGTGCCACAGGGATCTGGCTCTGTCCCAGGCCCTGTGGGGCTGGCAGTTGAGTAAGCAGTCAGGCTGGGCGCACCCATCCCTCCCCCACTCCCCACTGCCCAGCACAGTGCATTCATGCAGCTGGGCCCCACCCCATCTCCAGAGGCACCTTCCACTAGCAACAGTCTCCCCAGGCACAACACAGCTAACACAAGGCCCCGCAGGCAGGACTCTGGGACAGACGCAGGCCAGCTGCCCAGAGCCCAGACCAAGCATGGACGCCGTGGATGCCACCATGGAGAAACTCCGGGCACAGTGCCTGTCCCGCGGGGCCTCGGGCATCCAGGGCCTGGCCAGGTTTTTCCGCCAACTAGACCGGGACGGGAGCAGATCCCTGGACGCTGATGAGTTCCGGCAGGGTCTGGCCAAACTCGGGCTGGTGCTGGACCAGGCGGAGGCAGAGGGTGTGTGCAGGAAGTGGGACCGCAATGGCAGCGGGACGCTGGATCTGGAGGAGTTCCTTCGGGCGCTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCTGTCATCGCAGCTGCATTTGCCAAGCTGGACCGCAGTGGGGACGGCGTCGTGACGGTGGACGACCTCCGCGGGGTGTACAGTGGCCGTGCCCACCCCAAGGTGCGCAGTGGGGAGTGGACCGAGGACGAGGTGCTGCGCCGCTTCCTGGACAACTTCGACTCCTCTGAGAAGGACGGGCAGGTCACACTGGCGGAATTCCAGGACTACTACAGCGGCGTGAGTGCCTCCATGAACACGGATGAGGAGTTCGTGGCCATGATGACCAGTGCCTGGCAGCTGTGA
ORF Protein Sequence MQCHRDLALSQALWGWQLSKQSGWAHPSLPHSPLPSTVHSCSWAPPHLQRHLPLATVSPGTTQLTQGPAGRTLGQTQASCPEPRPSMDAVDATMEKLRAQCLSRGASGIQGLARFFRQLDRDGSRSLDADEFRQGLAKLGLVLDQAEAEGVCRKWDRNGSGTLDLEEFLRALRPPMSQAREAVIAAAFAKLDRSGDGVVTVDDLRGVYSGRAHPKVRSGEWTEDEVLRRFLDNFDSSEKDGQVTLAEFQDYYSGVSASMNTDEEFVAMMTSAWQL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2396-Ab Anti-CAPS monoclonal antibody
    Target Antigen GM-Tg-g-IP2396-Ag CAPS protein
    ORF Viral Vector pGMLV000249 Human CAPS Lentivirus plasmid
    ORF Viral Vector vGMLV000249 Human CAPS Lentivirus particle


    Target information

    Target ID GM-IP2396
    Target Name calcyphosine/Calcyphosine/CAPS
    Gene Group Identifier
    (Target Gene ID in Homo species)
    828
    Gene ID 100065259 (Equus caballus), 101094401 (Felis catus), 120094827 (Rattus norvegicus), 403965 (Canis lupus familiaris)
    616482 (Bos taurus), 700767 (Macaca mulatta), 828 (Homo sapiens)
    Gene Symbols & Synonyms CAPS,Caps,CAPS1
    Target Alternative Names calcyphosine, Calcyphosine, CAPS,Calcyphosin,Calcyphosine,CAPS1
    Uniprot Accession P10463,Q0VCC0,Q13938
    Additional SwissProt Accessions: P10463,Q0VCC0,Q13938
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSCAFG00845012225, ENSMMUG00000011963, ENSG00000105519
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.