Human AKT1/AKT/CWS6 ORF/cDNA clone-Lentivirus particle (NM_005163)

Cat. No.: vGMLV000222

Pre-made Human AKT1/AKT/CWS6 Lentiviral expression plasmid for AKT1 lentivirus packaging, AKT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AKT/AKT1/AKT1/AKT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000222 Human AKT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000222
Gene Name AKT1
Accession Number NM_005163
Gene ID 207
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1443 bp
Gene Alias AKT,CWS6,PKB,PKB-ALPHA,PRKBA,RAC,RAC-ALPHA
Fluorescent Reporter Firefly luciferase
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGA
ORF Protein Sequence MSDVAIVKEGWLHKRGEYIKTWRPRYFLLKNDGTFIGYKERPQDVDQREAPLNNFSVAQCQLMKTERPRPNTFIIRCLQWTTVIERTFHVETPEEREEWTTAIQTVADGLKKQEEEEMDFRSGSPSDNSGAEEMEVSLAKPKHRVTMNEFEYLKLLGKGTFGKVILVKEKATGRYYAMKILKKEVIVAKDEVAHTLTENRVLQNSRHPFLTALKYSFQTHDRLCFVMEYANGGELFFHLSRERVFSEDRARFYGAEIVSALDYLHSEKNVVYRDLKLENLMLDKDGHIKITDFGLCKEGIKDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHEKLFELILMEEIRFPRTLGPEAKSLLSGLLKKDPKQRLGGGSEDAKEIMQHRFFAGIVWQHVYEKKLSPPFKPQVTSETDTRYFDEEFTAQMITITPPDQDDSMECVDSERRPHFPQFSYSASGTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67619-Ab Anti-AKT1 monoclonal antibody
    Target Antigen GM-Tg-g-T67619-Ag AKT1 protein
    ORF Viral Vector pGMLP005423 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLP005606 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLP005800 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000222 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000429 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV001602 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMAP000133 Human AKT1 Adenovirus plasmid
    ORF Viral Vector pGMPC000431 Human AKT1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005423 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLP005606 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLP005800 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV000222 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV000429 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV001602 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMAP000133 Human AKT1 Adenovirus particle


    Target information

    Target ID GM-T67619
    Target Name AKT/AKT1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    207
    Gene ID 100061130 (Equus caballus), 101087931 (Felis catus), 11651 (Mus musculus), 207 (Homo sapiens)
    24185 (Rattus norvegicus), 280991 (Bos taurus), 490878 (Canis lupus familiaris), 697747 (Macaca mulatta)
    Gene Symbols & Synonyms AKT1,Akt1,Akt,PKB,Rac,LTR-akt,PKB/Akt,PKBalpha,AKT,RAC,PRKBA,PKB-ALPHA,RAC-ALPHA
    Target Alternative Names AKT, AKT1,RAC-alpha serine/threonine-protein kinase,Protein kinase B (PKB), Protein kinase B alpha (PKB alpha), Proto-oncogene c-Akt, RAC-PK-alpha,AKT,PKB,RAC,PRKBA,PKB-ALPHA,RAC-ALPHA
    Uniprot Accession P31749,P31750,P47196,Q01314
    Additional SwissProt Accessions: P31750,P31749,P47196,Q01314
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer, Non-Small Cell Lung Cancer
    Disease from KEGG EGFR tyrosine kinase inhibitor resistance, Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, cAMP signaling pathway, Chemokine signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Longevity regulating pathway, Longevity regulating pathway - multiple species, Cellular senescence, Adrenergic signaling in cardiomyocytes, Osteoclast differentiation, Focal adhesion, Signaling pathways regulating pluripotency of stem cells, Platelet activation, Toll-like receptor signaling pathway, C-type lectin receptor signaling pathway, JAK-STAT signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Cholinergic synapse, Prolactin signaling pathway, Thyroid hormone signaling pathway, Adipocytokine signaling pathway, Regulation of lipolysis in adipocytes, Relaxin signaling pathway, GnRH secretion, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Carbohydrate digestion and absorption, Alzheimer disease, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Central carbon metabolism in cancer, Choline metabolism in cancer, PD-L1 expression and PD-1 checkpoint pathway in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000008264, ENSMUSG00000001729, ENSG00000142208, ENSBTAG00000017636, ENSCAFG00845021825, ENSMMUG00000001044
    Target Classification Kinase


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.