Human CCND1/BCL1/D11S287E ORF/cDNA clone-Lentivirus particle (NM_053056.2)
Cat. No.: vGMLV000042
Pre-made Human CCND1/BCL1/D11S287E Lentiviral expression plasmid for CCND1 lentivirus packaging, CCND1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
Cyclin D1/CCND1/CCND1/BCL1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV000042 | Human CCND1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV000042 |
| Gene Name | CCND1 |
| Accession Number | NM_053056.2 |
| Gene ID | 595 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 888 bp |
| Gene Alias | BCL1,D11S287E,PRAD1,U21B31 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGACCCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA |
| ORF Protein Sequence | MEHQLLCCEVETIRRAYPDANLLNDRVLRAMLKAEETCAPSVSYFKCVQKEVLPSMRKIVATWMLEVCEEQKCEEEVFPLAMNYLDRFLSLEPVKKSRLQLLGATCMFVASKMKETIPLTAEKLCIYTDNSIRPEELLQMELLLVNKLKWNLAAMTPHDFIEHFLSKMPEAEENKQIIRKHAQTFVALCATDVKFISNPPSMVAAGSVVAAVQGLNLRSPNNFLSYYRLTRFLSRVIKCDPDCLRACQEQIEALLESSLRQAQQNMDPKAAEEEEEEEEEVDLACTPTDVRDVDI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T12355-Ab | Anti-CCND1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T12355-Ag | CCND1 protein |
| ORF Viral Vector | pGMLP005612 | Human CCND1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000042 | Human CCND1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000670 | Human CCND1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002266 | Human CCND1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000562 | Human CCND1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000006 | Human CCND1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC000351 | Human CCND1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP005612 | Human CCND1 Lentivirus particle |
| ORF Viral Vector | vGMLV000042 | Human CCND1 Lentivirus particle |
| ORF Viral Vector | vGMLV000670 | Human CCND1 Lentivirus particle |
| ORF Viral Vector | vGMLV002266 | Human CCND1 Lentivirus particle |
| ORF Viral Vector | vGMAP000562 | Human CCND1 Adenovirus particle |
Target information
| Target ID | GM-T12355 |
| Target Name | Cyclin D1/CCND1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
595 |
| Gene ID |
100037407 (Felis catus), 102149114 (Equus caballus), 12443 (Mus musculus), 449028 (Canis lupus familiaris) 524530 (Bos taurus), 574320 (Macaca mulatta), 58919 (Rattus norvegicus), 595 (Homo sapiens) |
| Gene Symbols & Synonyms | CCND1,Ccnd1,cD1,CycD1,Cyl-1,PRAD1,bcl-1,BCL1,U21B31,D11S287E |
| Target Alternative Names | B-cell lymphoma 1 protein (BCL-1),BCL-1 oncogene,BCL1,CCND1,Ccnd1,CycD1,Cyclin D1,Cyl-1,D11S287E,G1/S-specific cyclin-D1,PRAD1,PRAD1 oncogene,U21B31,bcl-1,cD1 |
| Uniprot Accession |
P24385,P25322,P39948,Q2KI22,Q64HP0
Additional SwissProt Accessions: P25322,Q64HP0,Q2KI22,P39948,P24385 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer, Breast Cancer, Head and neck squamous cell carcinoma (HNSCC), tumor, Cancer, Breast cancer |
| Disease from KEGG | Endocrine resistance, FoxO signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Cellular senescence, Wnt signaling pathway, Hippo signaling pathway, Focal adhesion, Tight junction, JAK-STAT signaling pathway, Prolactin signaling pathway, Thyroid hormone signaling pathway, Oxytocin signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Cushing syndrome, Alcoholic liver disease, Hepatitis C, Measles, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Viral myocarditis |
| Gene Ensembl | ENSMUSG00000070348, ENSMMUG00000002368, ENSG00000110092 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


