Human PYY/PYY-I/PYY1 ORF/cDNA clone-Lentivirus particle (NM_004160)

Cat. No.: vGMLP004964

Pre-made Human PYY/PYY-I/PYY1 Lentiviral expression plasmid for PYY lentivirus packaging, PYY lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to peptide YY/PYY/PYY/PYY-I products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004964 Human PYY Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004964
Gene Name PYY
Accession Number NM_004160
Gene ID 5697
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 294 bp
Gene Alias PYY-I,PYY1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGTTCGTGCGCAGGCCGTGGCCCGCCTTGACCACAGTGCTTCTGGCCCTGCTCGTCTGCCTAGGGGCGCTGGTCGACGCCTACCCCATCAAACCCGAGGCTCCCCGCGAAGACGCCTCGCCGGAGGAGCTGAACCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGTCACCCGGCAGCGGTATGGGAAAAGAGACGGCCCGGACACGCTTCTTTCCAAAACGTTCTTCCCCGACGGCGAGGACCGCCCCGTCAGGTCGCGGTCGGAGGGCCCAGACCTGTGGTGA
ORF Protein Sequence MVFVRRPWPALTTVLLALLVCLGALVDAYPIKPEAPREDASPEELNRYYASLRHYLNLVTRQRYGKRDGPDTLLSKTFFPDGEDRPVRSRSEGPDLW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24127-Ab Anti-PYY/ PYY-I1 functional antibody
    Target Antigen GM-Tg-g-T24127-Ag PYY protein
    ORF Viral Vector pGMLP004964 Human PYY Lentivirus plasmid
    ORF Viral Vector vGMLP004964 Human PYY Lentivirus particle


    Target information

    Target ID GM-T24127
    Target Name peptide YY/PYY
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5697
    Gene ID 100051539 (Equus caballus), 105261189 (Felis catus), 217212 (Mus musculus), 287730 (Rattus norvegicus)
    5697 (Homo sapiens), 607156 (Canis lupus familiaris), 714041 (Macaca mulatta)
    Gene Symbols & Synonyms PYY,Pyy,Yy,GHYY,RATGHYY,peptide-YY,PYY1,PYY-I
    Target Alternative Names peptide YY, PYY,Peptide YY,PYY,PYY-I, Peptide tyrosine tyrosine,PYY1,PYY-I
    Uniprot Accession P10082,P10631,P68004,Q9EPS2
    Additional SwissProt Accessions: Q9EPS2,P10631,P10082,P68004
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG Neuroactive ligand-receptor interaction
    Gene Ensembl ENSECAG00000015113, ENSMUSG00000017311, ENSG00000131096, ENSCAFG00845009862, ENSMMUG00000009715
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.