Human AQP2/AQP-CD/WCH-CD ORF/cDNA clone-Lentivirus particle (NM_000486)

Cat. No.: vGMLP004936

Pre-made Human AQP2/AQP-CD/WCH-CD Lentiviral expression plasmid for AQP2 lentivirus packaging, AQP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AQP2/AQP-CD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004936 Human AQP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004936
Gene Name AQP2
Accession Number NM_000486
Gene ID 359
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 816 bp
Gene Alias AQP-CD,WCH-CD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGGAGCTCCGCTCCATAGCCTTCTCCAGGGCTGTGTTCGCAGAGTTCCTGGCCACACTCCTCTTCGTCTTCTTTGGCCTCGGCTCTGCCCTCAACTGGCCACAGGCCCTGCCCTCTGTGCTACAGATTGCCATGGCGTTTGGCTTGGGTATTGGCACCCTGGTACAGGCTCTGGGCCACATAAGCGGGGCCCACATCAACCCTGCCGTGACTGTGGCCTGCCTGGTGGGCTGCCACGTCTCCGTTCTCCGAGCCGCCTTCTACGTGGCTGCCCAGCTGCTGGGGGCTGTGGCCGGAGCCGCTCTGCTCCATGAGATCACGCCAGCAGACATCCGCGGGGACCTGGCTGTCAATGCTCTCAGCAACAGCACGACGGCTGGCCAGGCGGTGACTGTGGAGCTCTTCCTGACACTGCAGCTGGTGCTCTGCATCTTCGCCTCCACCGATGAGCGCCGCGGAGAGAACCCGGGCACCCCTGCTCTCTCCATAGGCTTCTCTGTGGCCCTGGGCCACCTCCTTGGGATCCATTACACCGGCTGCTCTATGAATCCTGCCCGCTCCCTGGCTCCAGCTGTCGTCACTGGCAAATTTGATGACCACTGGGTCTTCTGGATCGGACCCCTGGTGGGCGCCATCCTGGGCTCCCTCCTCTACAACTACGTGCTGTTTCCGCCAGCCAAGAGCCTGTCGGAGCGCCTGGCAGTGCTGAAGGGCCTGGAGCCGGACACCGATTGGGAGGAGCGCGAGGTGCGACGGCGGCAGTCGGTGGAGCTGCACTCGCCGCAGAGCCTGCCACGGGGTACCAAGGCCTGA
ORF Protein Sequence MWELRSIAFSRAVFAEFLATLLFVFFGLGSALNWPQALPSVLQIAMAFGLGIGTLVQALGHISGAHINPAVTVACLVGCHVSVLRAAFYVAAQLLGAVAGAALLHEITPADIRGDLAVNALSNSTTAGQAVTVELFLTLQLVLCIFASTDERRGENPGTPALSIGFSVALGHLLGIHYTGCSMNPARSLAPAVVTGKFDDHWVFWIGPLVGAILGSLLYNYVLFPPAKSLSERLAVLKGLEPDTDWEEREVRRRQSVELHSPQSLPRGTKA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0079-Ab Anti-AQP2/ AQP-CD/ WCH-CD monoclonal antibody
    Target Antigen GM-Tg-g-MP0079-Ag AQP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004936 Human AQP2 Lentivirus plasmid
    ORF Viral Vector vGMLP004936 Human AQP2 Lentivirus particle


    Target information

    Target ID GM-MP0079
    Target Name AQP2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    359
    Gene ID 100059758 (Equus caballus), 101092948 (Felis catus), 11827 (Mus musculus), 25386 (Rattus norvegicus)
    359 (Homo sapiens), 486552 (Canis lupus familiaris), 539870 (Bos taurus), 711719 (Macaca mulatta)
    Gene Symbols & Synonyms AQP2,Aqp2,aqp5,cph,jpk,AQP-CD,WCH-CD,AQP-2,aquaporin-2,NDI2
    Target Alternative Names ADH water channel,AQP-2,AQP-CD,AQP2,Aqp2,Aquaporin-2,Aquaporin-CD (AQP-CD),Collecting duct water channel protein,NDI2,WCH-CD,Water channel protein for renal collecting duct,aqp5,aquaporin-2,cph,jpk
    Uniprot Accession P34080,P41181,P56402,P79099,P79144,P79165
    Additional SwissProt Accessions: P79165,P56402,P34080,P41181,P79144,P79099
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease Diabetes insipidus, Nephrotoxicity, Nocturnal enuresis, Renal tubulo-interstitial diseases
    Disease from KEGG
    Gene Ensembl ENSECAG00000023681, ENSMUSG00000023013, ENSG00000167580, ENSCAFG00845018399, ENSBTAG00000008374, ENSMMUG00000038256
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.