Human PGC/PEPC/PGII ORF/cDNA clone-Lentivirus particle (NM_001166424)

Cat. No.: vGMLP004753

Pre-made Human PGC/PEPC/PGII Lentiviral expression plasmid for PGC lentivirus packaging, PGC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PGC/Pepsinogen II/PGC/PEPC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004753 Human PGC Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004753
Gene Name PGC
Accession Number NM_001166424
Gene ID 5225
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 948 bp
Gene Alias PEPC,PGII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGTGGATGGTGGTGGTCTTGGTCTGCCTCCAGCTCTTGGAGGCAGCAGTGGTCAAAGTGCCCCTGAAGAAATTTAAGTCTATCCGTGAGACCATGAAGGAGAAGGGCTTGCTGGGGGAGTTCCTGAGGACCCACAAGTATGATCCTGCTTGGAAGTACCGCTTTGGTGACCTCAGCGTGACCTACGAGCCCATGGCCTACATGGATGCTGCCTACTTTGGTGAGATCAGCATCGGGACTCCACCCCAGAACTTCCTGGTCCTTTTTGACACCGGCTCCTCCAACTTGTGGGTGCCCTCTGTCTACTGCCAGAGCCAGGCCTGCACCAGTCACTCCCGCTTCAACCCCAGCGAGTCGTCCACCTACTCCACCAATGGGCAGACCTTCTCCCTGCAGTATGGCAGTGGCAGCCTCACCGGCTTCTTTGGCTATGACACCCTGACTGTCCAGAGCATCCAGGTCCCCAACCAGGAGTTCGGCTTGAGTGAGAATGAGCCTGGTACCAACTTCGTCTATGCGCAGTTTGATGGCATCATGGGCCTGGCCTACCCTGCTCTGTCCGTGGATGAGGCCACCACAGCTATGCAGGGCATGGTGCAGGAGGGCGCCCTCACCAGCCCCGTCTTCAGCGTCTACCTCAGCAACCTGGTCCTGGAGTCTTCTGGTCTAGGTCCACTGCTGACCCCTAGCAGAGCAGCTCCACCCAGCTCCACACTCCAGCTACCAGAGAAGCCTCTGGAACAAACATGGAATATCCTTACCCCCTTCACCAAGACCCTACCTGTCTCCAATCTCAGCAGAAAAGTAACAAGCTGGGCCGGGGTGGGGATCCCGGTGACATGTCTACCAGAGGCAGGAAGCGGAGGGGAGAGGAGAGCAGAGTGTGGGCTGGGGGTCCCAACCACTAGGGGACCCCCCAGAAGTCAGCATCATTCGGGAGCCTGA
ORF Protein Sequence MKWMVVVLVCLQLLEAAVVKVPLKKFKSIRETMKEKGLLGEFLRTHKYDPAWKYRFGDLSVTYEPMAYMDAAYFGEISIGTPPQNFLVLFDTGSSNLWVPSVYCQSQACTSHSRFNPSESSTYSTNGQTFSLQYGSGSLTGFFGYDTLTVQSIQVPNQEFGLSENEPGTNFVYAQFDGIMGLAYPALSVDEATTAMQGMVQEGALTSPVFSVYLSNLVLESSGLGPLLTPSRAAPPSSTLQLPEKPLEQTWNILTPFTKTLPVSNLSRKVTSWAGVGIPVTCLPEAGSGGERRAECGLGVPTTRGPPRSQHHSGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T45601-Ab Anti-PEPC/ PGC/ PGII functional antibody
    Target Antigen GM-Tg-g-T45601-Ag PGC protein
    ORF Viral Vector pGMLP004753 Human PGC Lentivirus plasmid
    ORF Viral Vector vGMLP004753 Human PGC Lentivirus particle


    Target information

    Target ID GM-T45601
    Target Name PGC/Pepsinogen II
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5225
    Gene ID 100066460 (Equus caballus), 101100053 (Felis catus), 109820 (Mus musculus), 24864 (Rattus norvegicus)
    514502 (Bos taurus), 5225 (Homo sapiens), 609052 (Canis lupus familiaris), 695713 (Macaca mulatta)
    Gene Symbols & Synonyms PGC,Pgc,Upg1,Upg-1,2210410L06Rik,PG1,Pg-1,PEPC,PGII
    Target Alternative Names PGC, Pepsinogen II,Gastricsin,Pepsinogen C,PEPC,PGII
    Uniprot Accession P04073,P20142,Q9D7R7
    Additional SwissProt Accessions: Q9D7R7,P04073,P20142
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Prostate Cancer
    Disease from KEGG
    Gene Ensembl ENSMUSG00000023987, ENSBTAG00000003818, ENSG00000096088, ENSMMUG00000048466
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.