Human CYBA/p22-PHOX ORF/cDNA clone-Lentivirus particle (NM_000101)

Cat. No.: vGMLP004603

Pre-made Human CYBA/p22-PHOX Lentiviral expression plasmid for CYBA lentivirus packaging, CYBA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CYBA/p22-PHOX products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004603 Human CYBA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004603
Gene Name CYBA
Accession Number NM_000101
Gene ID 1535
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 588 bp
Gene Alias p22-PHOX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCAGATCGAGTGGGCCATGTGGGCCAACGAACAGGCGCTGGCGTCCGGCCTGATCCTCATCACCGGGGGCATCGTGGCCACAGCTGGGCGCTTCACCCAGTGGTACTTTGGTGCCTACTCCATTGTGGCGGGCGTGTTTGTGTGCCTGCTGGAGTACCCCCGGGGGAAGAGGAAGAAGGGCTCCACCATGGAGCGCTGGGGACAGAAGTACATGACCGCCGTGGTGAAGCTGTTCGGGCCCTTTACCAGGAATTACTATGTTCGGGCCGTCCTGCATCTCCTGCTCTCGGTGCCCGCCGGCTTCCTGCTGGCCACCATCCTTGGGACCGCCTGCCTGGCCATTGCGAGCGGCATCTACCTACTGGCGGCTGTGCGTGGCGAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCGGAGGCACCATCAAGCAGCCGCCCAGCAACCCCCCGCCGCGGCCCCCGGCCGAGGCCCGCAAGAAGCCCAGCGAGGAGGAGGCTGCGGTGGCGGCGGGGGGACCCCCGGGAGGTCCCCAGGTCAACCCCATCCCGGTGACCGACGAGGTCGTGTGA
ORF Protein Sequence MGQIEWAMWANEQALASGLILITGGIVATAGRFTQWYFGAYSIVAGVFVCLLEYPRGKRKKGSTMERWGQKYMTAVVKLFGPFTRNYYVRAVLHLLLSVPAGFLLATILGTACLAIASGIYLLAAVRGEQWTPIEPKPRERPQIGGTIKQPPSNPPPRPPAEARKKPSEEEAAVAAGGPPGGPQVNPIPVTDEVV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0344-Ab Anti-CY24A/ CYBA/ p22-PHOX monoclonal antibody
    Target Antigen GM-Tg-g-MP0344-Ag CYBA VLP (virus-like particle)
    ORF Viral Vector pGMLP004603 Human CYBA Lentivirus plasmid
    ORF Viral Vector vGMLP004603 Human CYBA Lentivirus particle


    Target information

    Target ID GM-MP0344
    Target Name CYBA
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1535
    Gene ID 100049843 (Equus caballus), 101091745 (Felis catus), 13057 (Mus musculus), 1535 (Homo sapiens)
    281111 (Bos taurus), 489664 (Canis lupus familiaris), 696748 (Macaca mulatta), 79129 (Rattus norvegicus)
    Gene Symbols & Synonyms CYBA,Cyba,b558,nmf333,p22phox,p22-phox,CGD4,p22-PHOX,Phox
    Target Alternative Names CGD4,CYBA,Cyba,Cytochrome b(558) alpha chain,Cytochrome b-245 light chain,Cytochrome b558 subunit alpha,Neutrophil cytochrome b 22 kDa polypeptide,Phox,Superoxide-generating NADPH oxidase light chain subunit,b558,nmf333,p22 phagocyte B-cytochrome,p22-PHOX,p22-phox,p22-phox (p22phox),p22phox
    Uniprot Accession O46521,P13498,Q61462,Q62737
    Additional SwissProt Accessions: Q61462,P13498,O46521,Q62737
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease cancer
    Disease from KEGG Phagosome, Osteoclast differentiation, NOD-like receptor signaling pathway, Leukocyte transendothelial migration, Leishmaniasis, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSMUSG00000006519, ENSG00000051523, ENSBTAG00000061619, ENSCAFG00845003520, ENSMMUG00000053929
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.