Human TNFRSF17/BCM/BCMA ORF/cDNA clone-Lentivirus particle (NM_001192)

Cat. No.: vGMLP004529

Pre-made Human TNFRSF17/BCM/BCMA Lentiviral expression plasmid for TNFRSF17 lentivirus packaging, TNFRSF17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TNFRSF17/BCMA/CD269/TNFRSF17/BCM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004529 Human TNFRSF17 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004529
Gene Name TNFRSF17
Accession Number NM_001192
Gene ID 608
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 555 bp
Gene Alias BCM,BCMA,CD269,TNFRSF13A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGCAGATGGCTGGGCAGTGCTCCCAAAATGAATATTTTGACAGTTTGTTGCATGCTTGCATACCTTGTCAACTTCGATGTTCTTCTAATACTCCTCCTCTAACATGTCAGCGTTATTGTAATGCAAGTGTGACCAATTCAGTGAAAGGAACGAATGCGATTCTCTGGACCTGTTTGGGACTGAGCTTAATAATTTCTTTGGCAGTTTTCGTGCTAATGTTTTTGCTAAGGAAGATAAACTCTGAACCATTAAAGGACGAGTTTAAAAACACAGGATCAGGTCTCCTGGGCATGGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAATTATTCTTCCGAGAGGCCTCGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCAAGAGCAAACCGAAGGTCGACTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCAACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGAGTGCTACGGAGATAGAGAAATCAATTTCTGCTAGGTAA
ORF Protein Sequence MLQMAGQCSQNEYFDSLLHACIPCQLRCSSNTPPLTCQRYCNASVTNSVKGTNAILWTCLGLSLIISLAVFVLMFLLRKINSEPLKDEFKNTGSGLLGMANIDLEKSRTGDEIILPRGLEYTVEECTCEDCIKSKPKVDSDHCFPLPAMEEGATILVTTKTNDYCKSLPAALSATEIEKSISAR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-752 Pre-Made Belantamab Mafodotin Biosimilar, Whole Mab Adc, Anti-Tnfrsf17 Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-663 Pre-Made Elranatamab biosimilar, Whole mAb, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-433 Pre-Made Pavurutamab biosimilar, Bispecific scFv, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-055 Pre-Made Belantamab biosimilar, Whole mAb ADC, Anti-TNFRSF17 Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A therapeutic antibody
    Biosimilar GMP-Bios-ab-421 Pre-Made Pacanalotamab biosimilar, Bispecific scFv, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-018 Pre-Made Alnuctamab biosimilar, Bispecific mAb with Domain Crossover, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-557 Pre-Made Teclistamab biosimilar, Bispecific mAb, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Target Antibody GM-Tg-g-T66693-Ab Anti-TNR17/ TNFRSF17/ BCM monoclonal antibody
    Target Antigen GM-Tg-g-T66693-Ag TNFRSF17 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T66693 tumor necrosis factor receptor superfamily, member 17 (TNFRSF17) protein & antibody
    ORF Viral Vector pGMLP004529 Human TNFRSF17 Lentivirus plasmid
    ORF Viral Vector vGMLP004529 Human TNFRSF17 Lentivirus particle


    Target information

    Target ID GM-T66693
    Target Name TNFRSF17/BCMA/CD269
    Gene Group Identifier
    (Target Gene ID in Homo species)
    608
    Gene ID 100055833 (Equus caballus), 100684674 (Canis lupus familiaris), 101086618 (Felis catus), 101908051 (Bos taurus)
    21935 (Mus musculus), 287034 (Rattus norvegicus), 608 (Homo sapiens), 712212 (Macaca mulatta)
    Gene Symbols & Synonyms TNFRSF17,Tnfrsf17,BCM,BCMA,Tnfrsf13,Tnfrsf13a,CD269,TNFRSF13A
    Target Alternative Names B-cell maturation protein,BCM,BCMA,CD269,TNFRSF13A,TNFRSF17,Tnfrsf13,Tnfrsf13a,Tnfrsf17,Tumor necrosis factor receptor superfamily member 17
    Uniprot Accession O88472,Q02223
    Additional SwissProt Accessions: O88472,Q02223
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, Intestinal immune network for IgA production
    Gene Ensembl ENSECAG00000020490, ENSCAFG00845012002, ENSBTAG00000049285, ENSMUSG00000022496, ENSG00000048462, ENSMMUG00000021520
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.