Human OPALIN/HTMP10/TMEM10 ORF/cDNA clone-Lentivirus particle (NM_033207)

Cat. No.: vGMLP004392

Pre-made Human OPALIN/HTMP10/TMEM10 Lentiviral expression plasmid for OPALIN lentivirus packaging, OPALIN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to OPALIN/HTMP10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004392 Human OPALIN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004392
Gene Name OPALIN
Accession Number NM_033207
Gene ID 93377
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 426 bp
Gene Alias HTMP10,TMEM10,TMP10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTTTTTCACTGAACTTCACCCTGCCGGCGAACACAACGTCCTCTCCTGTCACAGGTGGGAAAGAAACGGACTGTGGGCCCTCTCTTGGATTAGCGGCGGGCATACCATTGCTGGTGGCCACAGCCCTGCTGGTGGCTTTACTATTTACTTTGATTCACCGAAGAAGAAGCAGCATTGAGGCCATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCCAAGATATCTGAGAATCCTAGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCACATATATGTGAAGACTGTAGCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATGGAAAGAAGGAGGGGATTGTGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA
ORF Protein Sequence MSFSLNFTLPANTTSSPVTGGKETDCGPSLGLAAGIPLLVATALLVALLFTLIHRRRSSIEAMEESDRPCEISEIDDNPKISENPRRSPTHEKNTMGAQEAHIYVKTVAGSEEPVHDRYRPTIEMERRRGLWWLVPRLSLE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0919-Ab Anti-OPALI/ OPALIN/ HTMP10 monoclonal antibody
    Target Antigen GM-Tg-g-MP0919-Ag OPALIN VLP (virus-like particle)
    ORF Viral Vector pGMLP004392 Human OPALIN Lentivirus plasmid
    ORF Viral Vector vGMLP004392 Human OPALIN Lentivirus particle


    Target information

    Target ID GM-MP0919
    Target Name OPALIN
    Gene Group Identifier
    (Target Gene ID in Homo species)
    93377
    Gene ID 100630111 (Equus caballus), 101097350 (Felis catus), 226115 (Mus musculus), 361757 (Rattus norvegicus)
    608634 (Canis lupus familiaris), 616443 (Bos taurus), 704725 (Macaca mulatta), 93377 (Homo sapiens)
    Gene Symbols & Synonyms OPALIN,Opalin,Tmp10,Tmem10,TMEM10,TMP10,HTMP10
    Target Alternative Names HTMP10,OPALIN,Oligodendrocytic myelin paranodal and inner loop protein,Opalin,TMEM10,TMP10,Tmem10,Tmp10,Transmembrane protein 10
    Uniprot Accession Q5E9I3,Q7M750,Q96PE5
    Additional SwissProt Accessions: Q7M750,Q5E9I3,Q96PE5
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000053690, ENSMUSG00000050121, ENSCAFG00845026993, ENSBTAG00000011740, ENSMMUG00000050856, ENSG00000197430
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.