Human ZD52F10/UNQ729 ORF/cDNA clone-Lentivirus particle (BC011886)
Cat. No.: vGMLP004013
Pre-made Human ZD52F10/UNQ729 Lentiviral expression plasmid for ZD52F10 lentivirus packaging, ZD52F10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
DMKN/ZD52F10/UNQ729 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004013 | Human ZD52F10 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004013 |
Gene Name | ZD52F10 |
Accession Number | BC011886 |
Gene ID | 93099 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 414 bp |
Gene Alias | UNQ729 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTTTAACTTTGACACTTTCTGGAAGAATTTTAAATCCAAGCTGGGTTTCATCAACTGGGATGCCATAAACAAGAACCAGGTCCCGCCCCCCAGCACCCGAGCCCTCCTCTACTTCAGCCGACTCTGGGAGGATTTCAAACAGAACACTCCTTTCCTCAACTGGAAAGCAATTATTGAGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGAGCCGATCAGCCGGGTGCAGGATGGCAGGAGGTGGCAGCTGTAACTTCCAAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTACTCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAACCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG |
ORF Protein Sequence | MFNFDTFWKNFKSKLGFINWDAINKNQVPPPSTRALLYFSRLWEDFKQNTPFLNWKAIIEGADASSLQKRAGRADQPGAGWQEVAAVTSKNYNYNQHAYPTAYGGKYSVKTPAKGGVSPSSSASRVQPGLLQWVKFW |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0890-Ab | Anti-DMKN/ UNQ729/ ZD52F10 functional antibody |
Target Antigen | GM-Tg-g-SE0890-Ag | DMKN protein |
ORF Viral Vector | pGMLP004013 | Human ZD52F10 Lentivirus plasmid |
ORF Viral Vector | vGMLP004013 | Human ZD52F10 Lentivirus particle |
Target information
Target ID | GM-SE0890 |
Target Name | DMKN |
Gene Group Identifier (Target Gene ID in Homo species) |
93099 |
Gene ID |
101100017 (Felis catus), 102150590 (Equus caballus), 361548 (Rattus norvegicus), 476484 (Canis lupus familiaris) 618159 (Bos taurus), 718709 (Macaca mulatta), 73712 (Mus musculus), 93099 (Homo sapiens) |
Gene Symbols & Synonyms | DMKN,Dmkn,RGD1561521,SK30,SK89,cI-36,C130074A08,1110014F24Rik,UNQ729,ZD52F10 |
Target Alternative Names | DMKN,Dermokine,Epidermis-specific secreted protein SK30/SK89,UNQ729,ZD52F10 |
Uniprot Accession |
A2VE23,Q6E0U4,Q6P253
Additional SwissProt Accessions: A2VE23,Q6P253,Q6E0U4 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | |
Disease | |
Disease from KEGG | |
Gene Ensembl | ENSECAG00000025084, ENSCAFG00845002671, ENSBTAG00000015912, ENSMMUG00000058405, ENSMUSG00000060962, ENSG00000161249 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.