Human CD37/GP52-40/TSPAN26 ORF/cDNA clone-Lentivirus particle (NM_001774)

Cat. No.: vGMLP003946

Pre-made Human CD37/GP52-40/TSPAN26 Lentiviral expression plasmid for CD37 lentivirus packaging, CD37 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CD37/GP52-40 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003946 Human CD37 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003946
Gene Name CD37
Accession Number NM_001774
Gene ID 951
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 846 bp
Gene Alias GP52-40,TSPAN26
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCAGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTTTTCAACCTCTTCTTCTTCGTCCTCGGCAGCCTGATCTTCTGCTTCGGCATCTGGATCCTCATTGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGGCCTTCGTGCCTCTGCAGATCTGGTCCAAAGTCCTGGCCATCTCAGGAATCTTCACCATGGGCATCGCCCTCCTGGGTTGTGTGGGGGCCCTCAAGGAGCTCCGCTGCCTCCTGGGCCTGTATTTTGGGATGCTGCTGCTCCTGTTTGCCACACAGATCACCCTGGGAATCCTCATCTCCACTCAGCGGGCCCAGCTGGAGCGAAGCTTGCGGGACGTCGTAGAGAAAACCATCCAAAAGTACGGCACCAACCCCGAGGAGACCGCGGCCGAGGAGAGCTGGGACTATGTGCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTACCCGCAGGACTGGTTCCAAGTCCTCATCCTGAGAGGTAACGGGTCGGAGGCGCACCGCGTGCCCTGCTCCTGCTACAACTTGTCGGCGACCAACGACTCCACAATCCTAGATAAGGTGATCTTGCCCCAGCTCAGCAGGCTTGGACACCTGGCGCGGTCCAGACACAGTGCAGACATCTGCGCTGTCCCTGCAGAGAGCCACATCTACCGCGAGGGCTGCGCGCAGGGCCTCCAGAAGTGGCTGCACAACAACCTTATTTCCATAGTGGGCATTTGCCTGGGCGTCGGCCTACTCGAGCTCGGGTTCATGACGCTCTCGATATTCCTGTGCAGAAACCTGGACCACGTCTACAACCGGCTCGCTCGATACCGTTAG
ORF Protein Sequence MSAQESCLSLIKYFLFVFNLFFFVLGSLIFCFGIWILIDKTSFVSFVGLAFVPLQIWSKVLAISGIFTMGIALLGCVGALKELRCLLGLYFGMLLLLFATQITLGILISTQRAQLERSLRDVVEKTIQKYGTNPEETAAEESWDYVQFQLRCCGWHYPQDWFQVLILRGNGSEAHRVPCSCYNLSATNDSTILDKVILPQLSRLGHLARSRHSADICAVPAESHIYREGCAQGLQKWLHNNLISIVGICLGVGLLELGFMTLSIFLCRNLDHVYNRLARYR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-364 Pre-Made Naratuximab biosimilar, Whole mAb ADC, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-ab-313 Pre-Made Lilotomab biosimilar, Whole mAb ADC, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-ab-416 Pre-Made Otlertuzumab biosimilar, di-scFv+Fc, Anti-CD37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-INN-904 Pre-Made Lutetium (177Lu) Lilotomab Satetraxetan Biosimilar, Radiolabelled Antibody, Anti-Cd37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody
    Biosimilar GMP-Bios-INN-924 Pre-Made Naratuximab Emtansine Biosimilar, Whole Mab Adc, Anti-Cd37 Antibody: Anti-GP52-40/TSPAN26 therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-673 Pre-Made Ivicentamab biosimilar, Whole mAb, Anti-CD37;CD37 Antibody: Anti-GP52-40/TSPAN26;GP52-40/TSPAN26 therapeutic antibody
    Target Antibody GM-Tg-g-IP0074-Ab Anti-CD37 monoclonal antibody
    Target Antigen GM-Tg-g-IP0074-Ag CD37 protein
    ORF Viral Vector pGMLP003946 Human CD37 Lentivirus plasmid
    ORF Viral Vector vGMLP003946 Human CD37 Lentivirus particle


    Target information

    Target ID GM-IP0074
    Target Name CD37
    Gene Group Identifier
    (Target Gene ID in Homo species)
    951
    Gene ID 100055274 (Equus caballus), 101099165 (Felis catus), 12493 (Mus musculus), 29185 (Rattus norvegicus)
    484382 (Canis lupus familiaris), 508751 (Bos taurus), 718718 (Macaca mulatta), 951 (Homo sapiens)
    Gene Symbols & Synonyms CD37,Cd37,Tspan26,GP52-40,TSPAN26
    Target Alternative Names CD37,Cd37,GP52-40,Leukocyte antigen CD37,TSPAN26,Tetraspanin-26 (Tspan-26),Tspan26
    Uniprot Accession P11049,P31053,Q2KHY8,Q61470
    Additional SwissProt Accessions: Q61470,P31053,Q2KHY8,P11049
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease
    Disease from KEGG Hematopoietic cell lineage
    Gene Ensembl ENSECAG00000014032, ENSMUSG00000030798, ENSBTAG00000011421, ENSMMUG00000014789, ENSG00000104894
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.