Human LAIR1/CD305/LAIR-1 ORF/cDNA clone-Lentivirus particle (BC027899)

Cat. No.: vGMLP003875

Pre-made Human LAIR1/CD305/LAIR-1 Lentiviral expression plasmid for LAIR1 lentivirus packaging, LAIR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LAIR1/CD305/LAIR1/CD305 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003875 Human LAIR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003875
Gene Name LAIR1
Accession Number BC027899
Gene ID 3903
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 864 bp
Gene Alias CD305,LAIR-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGAAGATCTGCCCAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGAGAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCTAGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGTGAAGGAAATGCCGGGCCTTATCGCTGCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAACCTCTGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCCTGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGTGTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTGA
ORF Protein Sequence MSPHPTALLGLVLCLAQTIHTQEEDLPRPSISAEPGTVIPLGSHVTFVCRGPVGVQTFRLERESRSTYNDTEDVSQASPSESEARFRIDSVSEGNAGPYRCIYYKPPKWSEQSDYLELLVKETSGGPDSPDTEPGSSAGPTQRPSDNSHNEHAPASQGLKAEHLYILIGVSVVFLFCLLLLVLFCLHRQNQIKQGPPRSKDEEQKPQQRPDLAVDVLERTADKATVNGLPEKDRETDTSALAAGSSQEVTYAQLDHWALTQRTARAVSPQSTKPMAESITYAAVARH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39047-Ab Anti-LAIR1/ CD305/ LAIR-1 monoclonal antibody
    Target Antigen GM-Tg-g-T39047-Ag LAIR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003510 Human LAIR1 Lentivirus plasmid
    ORF Viral Vector pGMLP003875 Human LAIR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003510 Human LAIR1 Lentivirus particle
    ORF Viral Vector vGMLP003875 Human LAIR1 Lentivirus particle


    Target information

    Target ID GM-T39047
    Target Name LAIR1/CD305
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3903
    Gene ID 101081847 (Felis catus), 3903 (Homo sapiens), 484308 (Canis lupus familiaris), 615295 (Bos taurus)
    Gene Symbols & Synonyms LAIR1,CD305,LAIR-1
    Target Alternative Names CD305,LAIR-1,LAIR1,Leukocyte-associated immunoglobulin-like receptor 1,hLAIR1
    Uniprot Accession Q6GTX8
    Additional SwissProt Accessions: Q6GTX8
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Pregnant state
    Disease from KEGG
    Gene Ensembl ENSG00000167613, ENSCAFG00845002261, ENSBTAG00000026080
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.