Human TGFB3/ARVD/ARVD1 ORF/cDNA clone-Lentivirus particle (NM_003239)

Cat. No.: vGMLP003661

Pre-made Human TGFB3/ARVD/ARVD1 Lentiviral expression plasmid for TGFB3 lentivirus packaging, TGFB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TGF Beta 3/TGFB3/TGFB3/ARVD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003661 Human TGFB3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003661
Gene Name TGFB3
Accession Number NM_003239
Gene ID 7043
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1239 bp
Gene Alias ARVD,ARVD1,LDS5,RNHF,TGF-beta3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTCAGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACGGTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTGGAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATACTATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTGGCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAGAAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGCTCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATTGCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTGTCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGTCTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAAAACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGCCGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTCATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGGGCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTCTACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTATGCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACGGTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCCCAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAGCTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA
ORF Protein Sequence MKMHLQRALVVLALLNFATVSLSLSTCTTLDFGHIKKKRVEAIRGQILSKLRLTSPPEPTVMTHVPYQVLALYNSTRELLEEMHGEREEGCTQENTESEYYAKEIHKFDMIQGLAEHNELAVCPKGITSKVFRFNVSSVEKNRTNLFRAEFRVLRVPNPSSKRNEQRIELFQILRPDEHIAKQRYIGGKNLPTRGTAEWLSFDVTDTVREWLLRRESNLGLEISIHCPCHTFQPNGDILENIHEVMEIKFKGVDNEDDHGRGDLGRLKKQKDHHNPHLILMMIPPHRLDNPGQGGQRKKRALDTNYCFRNLEENCCVRPLYIDFRQDLGWKWVHEPKGYYANFCSGPCPYLRSADTTHSTVLGLYNTLNPEASASPCCVPQDLEPLTILYYVGRTPKVEQLSNMVVKSCKCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22978-Ab Anti-TGFB3/ ARVD/ ARVD1 monoclonal antibody
    Target Antigen GM-Tg-g-T22978-Ag TGFB3 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T22978 transforming growth factor, beta 3 (TGFB3) protein & antibody
    ORF Viral Vector pGMLP003661 Human TGFB3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-039 Human TGFB3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-179 Human TGFB3 Adenovirus plasmid
    ORF Viral Vector vGMLP003661 Human TGFB3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-039 Human TGFB3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-179 Human TGFB3 Adenovirus particle


    Target information

    Target ID GM-T22978
    Target Name TGF Beta 3/TGFB3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7043
    Gene ID 100051765 (Equus caballus), 101098469 (Felis catus), 21809 (Mus musculus), 25717 (Rattus norvegicus)
    490796 (Canis lupus familiaris), 538957 (Bos taurus), 703239 (Macaca mulatta), 7043 (Homo sapiens)
    Gene Symbols & Synonyms TGFB3,Tgfb3,Tgfb-3,TGF-beta-3,TGF-B3,TGFbeta3,ARVD,LDS5,RNHF,ARVD1,TGF-beta3
    Target Alternative Names ARVD,ARVD1,LDS5,RNHF,TGF Beta 3,TGF-B3,TGF-beta-3,TGF-beta3,TGFB3,TGFbeta3,Tgfb-3,Tgfb3,Transforming growth factor beta-3 proprotein
    Uniprot Accession P10600,P17125,Q07258
    Additional SwissProt Accessions: P17125,Q07258,P10600
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease cancer, Breast Cancer
    Disease from KEGG MAPK signaling pathway, Cytokine-cytokine receptor interaction, FoxO signaling pathway, Cellular senescence, TGF-beta signaling pathway, Hippo signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Leishmaniasis, Chagas disease, Malaria, Toxoplasmosis, Amoebiasis, Tuberculosis, Hepatitis B, Human T-cell leukemia virus 1 infection, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hepatocellular carcinoma, Gastric cancer, Inflammatory bowel disease, Rheumatoid arthritis, Hypertrophic cardiomyopathy, Dilated cardiomyopathy
    Gene Ensembl ENSECAG00000015029, ENSMUSG00000021253, ENSCAFG00845015760, ENSBTAG00000012004, ENSMMUG00000012069, ENSG00000119699
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.