Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human KCNK3/K2p3.1/OAT1 ORF/cDNA clone-Lentivirus particle (NM_002246)
Cat. No.: vGMLP003639
Pre-made Human KCNK3/K2p3.1/OAT1 Lentiviral expression plasmid for KCNK3 lentivirus packaging, KCNK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
KCNK3/TASK1/KCNK3/K2p3.1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003639 | Human KCNK3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003639 |
| Gene Name | KCNK3 |
| Accession Number | NM_002246 |
| Gene ID | 3777 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1185 bp |
| Gene Alias | K2p3.1,OAT1,PPH4,TASK,TASK-1,TBAK1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGCGGCAGAACGTGCGCACGCTGGCGCTCATCGTGTGCACCTTCACCTACCTGCTGGTGGGCGCCGCGGTCTTCGACGCGCTGGAGTCGGAGCCCGAGCTGATCGAGCGGCAGCGGCTGGAGCTGCGGCAGCAGGAGCTGCGGGCGCGCTACAACCTCAGCCAGGGCGGCTACGAGGAGCTGGAGCGCGTCGTGCTGCGCCTCAAGCCGCACAAGGCCGGCGTGCAGTGGCGCTTCGCCGGCTCCTTCTACTTCGCCATCACCGTCATCACCACCATCGGCTACGGGCACGCGGCACCCAGCACGGATGGCGGCAAGGTGTTCTGCATGTTCTACGCGCTGCTGGGCATCCCGCTCACGCTCGTCATGTTCCAGAGCCTGGGCGAGCGCATCAACACCTTGGTGAGGTACCTGCTGCACCGCGCCAAGAAGGGGCTGGGCATGCGGCGCGCCGACGTGTCCATGGCCAACATGGTGCTCATCGGCTTCTTCTCGTGCATCAGCACGCTGTGCATCGGCGCCGCCGCCTTCTCCCACTACGAGCACTGGACCTTCTTCCAGGCCTACTACTACTGCTTCATCACCCTCACCACCATCGGCTTCGGCGACTACGTGGCGCTGCAGAAGGACCAGGCCCTGCAGACGCAGCCGCAGTACGTGGCCTTCAGCTTCGTCTACATCCTTACGGGCCTCACGGTCATCGGCGCCTTCCTCAACCTCGTGGTGCTGCGCTTCATGACCATGAACGCCGAGGACGAGAAGCGCGACGCCGAGCACCGCGCGCTGCTCACGCGCAACGGGCAGGCGGGCGGCGGCGGAGGGGGTGGCAGCGCGCACACTACGGACACCGCCTCATCCACGGCGGCAGCGGGCGGCGGCGGCTTCCGCAACGTCTACGCGGAGGTGCTGCACTTCCAGTCCATGTGCTCGTGCCTGTGGTACAAGAGCCGCGAGAAGCTGCAGTACTCCATCCCCATGATCATCCCGCGGGACCTCTCCACGTCCGACACGTGCGTGGAGCAGAGCCACTCGTCGCCGGGAGGGGGCGGCCGCTACAGCGACACGCCCTCGCGACGCTGCCTGTGCAGCGGGGCGCCACGCTCCGCCATCAGCTCGGTGTCCACGGGTCTGCACAGCCTGTCCACCTTCCGCGGCCTCATGAAGCGCAGGAGCTCCGTGTGA |
| ORF Protein Sequence | MKRQNVRTLALIVCTFTYLLVGAAVFDALESEPELIERQRLELRQQELRARYNLSQGGYEELERVVLRLKPHKAGVQWRFAGSFYFAITVITTIGYGHAAPSTDGGKVFCMFYALLGIPLTLVMFQSLGERINTLVRYLLHRAKKGLGMRRADVSMANMVLIGFFSCISTLCIGAAAFSHYEHWTFFQAYYYCFITLTTIGFGDYVALQKDQALQTQPQYVAFSFVYILTGLTVIGAFLNLVVLRFMTMNAEDEKRDAEHRALLTRNGQAGGGGGGGSAHTTDTASSTAAAGGGGFRNVYAEVLHFQSMCSCLWYKSREKLQYSIPMIIPRDLSTSDTCVEQSHSSPGGGGRYSDTPSRRCLCSGAPRSAISSVSTGLHSLSTFRGLMKRRSSV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T15795-Ab | Anti-KCNK3/ TASK1/ K2p3.1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T15795-Ag | TASK1/KCNK3 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003639 | Human KCNK3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003639 | Human KCNK3 Lentivirus particle |
Target information
| Target ID | GM-T15795 |
| Target Name | KCNK3/TASK1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3777 |
| Gene ID |
101082745 (Felis catus), 102150125 (Equus caballus), 16527 (Mus musculus), 29553 (Rattus norvegicus) 3777 (Homo sapiens), 483002 (Canis lupus familiaris), 519188 (Bos taurus), 699287 (Macaca mulatta) |
| Gene Symbols & Synonyms | KCNK3,Kcnk3,TASK,Task-1,cTBAK-1,rTASK,OAT1,PPH4,TASK1,TBAK1,K2p3.1,TASK-1 |
| Target Alternative Names | Acid-sensitive potassium channel protein TASK-1,K2p3.1,KCNK3,Kcnk3,OAT1,PPH4,Potassium channel subfamily K member 3,TASK,TASK-1,TASK1,TBAK1,TWIK-related acid-sensitive K(+) channel 1,Task-1,Two pore potassium channel KT3.1 (Two pore K(+) channel KT3.1),cTBAK-1,rTASK |
| Uniprot Accession |
O14649,O35111,O54912
Additional SwissProt Accessions: O35111,O54912,O14649 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | Aldosterone synthesis and secretion, Cortisol synthesis and secretion, Cushing syndrome |
| Gene Ensembl | ENSECAG00000038775, ENSMUSG00000049265, ENSG00000171303, ENSCAFG00845028885, ENSBTAG00000051102, ENSMMUG00000056208 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.