Human MFF/C2orf33/EMPF2 ORF/cDNA clone-Lentivirus particle (NM_020194)

Cat. No.: vGMLP003558

Pre-made Human MFF/C2orf33/EMPF2 Lentiviral expression plasmid for MFF lentivirus packaging, MFF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MFF/C2orf33 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003558 Human MFF Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003558
Gene Name MFF
Accession Number NM_020194
Gene ID 56947
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1029 bp
Gene Alias C2orf33,EMPF2,GL004
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTAAAGGAACAAGCAGTGACACATCACTAGGAAGGGTGAGCAGGGCAGCATTTCCTTCTCCCACTGCTGCTGAGATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCCCAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGCTAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGACCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTACTTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGAAATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAGCTGGTCAGAAATGATTCTCTGTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGATTTCTGCACCGGAGTACACTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAGACCTGTGTTGCGTGGTGGGTCTGCTGCCGCCACTTCTAATCCTCATCATGACAACGTCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG
ORF Protein Sequence MSKGTSSDTSLGRVSRAAFPSPTAAEMAEISRIQYEMEYTEGISQRMRVPEKLKVAPPNADLEQGFQEGVPNASVIMQVPERIVVAGNNEDVSFSRPADLDLIQSTPFKPLALKTPPRVLTLSERPLDFLDLERPPTTPQNEEIRAVGRLKRERSMSENAVRQNGQLVRNDSLWHRSDSAPRNKISRFQAPISAPEYTVTPSPQQARVCPPHMLPEDGANLSSARGILSLIQSSTRRAYQQILDVLDENRRPVLRGGSAAATSNPHHDNVRYGISNIDTTIEGTSDDLTVVDAASLRRQIIKLNRRLQLLEEENKERAKREMVMYSITVAFWLLNSWLWFRR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1171-Ab Anti-MFF monoclonal antibody
    Target Antigen GM-Tg-g-IP1171-Ag MFF protein
    ORF Viral Vector pGMLP003558 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-099 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-239 Human MFF Adenovirus plasmid
    ORF Viral Vector vGMLP003558 Human MFF Lentivirus particle
    ORF Viral Vector vGMLP-SPh-099 Human MFF Lentivirus particle
    ORF Viral Vector vGMAP-SPh-239 Human MFF Adenovirus particle


    Target information

    Target ID GM-IP1171
    Target Name MFF
    Gene Group Identifier
    (Target Gene ID in Homo species)
    56947
    Gene ID 100056853 (Equus caballus), 101087770 (Felis catus), 301563 (Rattus norvegicus), 477395 (Canis lupus familiaris)
    506291 (Bos taurus), 56947 (Homo sapiens), 708489 (Macaca mulatta), 75734 (Mus musculus)
    Gene Symbols & Synonyms MFF,Mff,RGD1310230,C2orf33,C2H2orf33,EMPF2,GL004,5230400G24Rik
    Target Alternative Names MFF,Mitochondrial fission factor,EMPF2,GL004,C2orf33
    Uniprot Accession Q3ZCD8,Q4KM98,Q6PCP5,Q9GZY8
    Additional SwissProt Accessions: Q4KM98,Q3ZCD8,Q9GZY8,Q6PCP5
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000004389, ENSCAFG00845015898, ENSBTAG00000021319, ENSG00000168958, ENSMMUG00000013246, ENSMUSG00000026150
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.