Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human FGF4/FGF-4/HBGF-4 ORF/cDNA clone-Lentivirus particle (NM_002007)
Cat. No.: vGMLP003446
Pre-made Human FGF4/FGF-4/HBGF-4 Lentiviral expression plasmid for FGF4 lentivirus packaging, FGF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
FGF-4/FGF4/FGF4/FGF-4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003446 | Human FGF4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003446 |
| Gene Name | FGF4 |
| Accession Number | NM_002007 |
| Gene ID | 2249 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 621 bp |
| Gene Alias | FGF-4,HBGF-4,HST,HST-1,HSTF-1,HSTF1,K-FGF,KFGF |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCGGGGCCCGGGACGGCCGCGGTAGCGCTGCTCCCGGCGGTCCTGCTGGCCTTGCTGGCGCCCTGGGCGGGCCGAGGGGGCGCCGCCGCACCCACTGCACCCAACGGCACGCTGGAGGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCTCTCGTTGGCGCGCCTGCCGGTGGCAGCGCAGCCCAAGGAGGCGGCCGTCCAGAGCGGCGCCGGCGACTACCTGCTGGGCATCAAGCGGCTGCGGCGGCTCTACTGCAACGTGGGCATCGGCTTCCACCTCCAGGCGCTCCCCGACGGCCGCATCGGCGGCGCGCACGCGGACACCCGCGACAGCCTGCTGGAGCTCTCGCCCGTGGAGCGGGGCGTGGTGAGCATCTTCGGCGTGGCCAGCCGGTTCTTCGTGGCCATGAGCAGCAAGGGCAAGCTCTATGGCTCGCCCTTCTTCACCGATGAGTGCACGTTCAAGGAGATTCTCCTTCCCAACAACTACAACGCCTACGAGTCCTACAAGTACCCCGGCATGTTCATCGCCCTGAGCAAGAATGGGAAGACCAAGAAGGGGAACCGAGTGTCGCCCACCATGAAGGTCACCCACTTCCTCCCCAGGCTGTGA |
| ORF Protein Sequence | MSGPGTAAVALLPAVLLALLAPWAGRGGAAAPTAPNGTLEAELERRWESLVALSLARLPVAAQPKEAAVQSGAGDYLLGIKRLRRLYCNVGIGFHLQALPDGRIGGAHADTRDSLLELSPVERGVVSIFGVASRFFVAMSSKGKLYGSPFFTDECTFKEILLPNNYNAYESYKYPGMFIALSKNGKTKKGNRVSPTMKVTHFLPRL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T28076-Ab | Anti-FGF4/ FGF-4/ HBGF-4 functional antibody |
| Target Antigen | GM-Tg-g-T28076-Ag | FGF4 protein |
| Cytokine | cks-Tg-g-GM-T28076 | fibroblast growth factor 4 (FGF4) protein & antibody |
| ORF Viral Vector | pGMLP003446 | Human FGF4 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003446 | Human FGF4 Lentivirus particle |
Target information
| Target ID | GM-T28076 |
| Target Name | FGF-4/FGF4 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
2249 |
| Gene ID |
100060525 (Equus caballus), 111556546 (Felis catus), 116499 (Rattus norvegicus), 14175 (Mus musculus) 2249 (Homo sapiens), 483680 (Canis lupus familiaris), 618474 (Bos taurus), 709016 (Macaca mulatta) |
| Gene Symbols & Synonyms | FGF4,Fgf4,Hst,Hst1,Fgf7a,KS3,hst,Fgfk,kFGF,Fgf-4,hst-1,HBGF-4,Hstf-1,HST,KFGF,FGF-4,HST-1,HSTF1,K-FGF,HSTF-1 |
| Target Alternative Names | FGF-4,FGF4,Fgf-4,Fgf4,Fgf7a,Fgfk,Fibroblast growth factor 4,HBGF-4,HST,HST-1,HSTF-1,HSTF-1),HSTF1,Heparin secretory-transforming protein 1 (HST,Heparin-binding growth factor 4 (HBGF-4),Hst,Hst1,Hstf-1,K-FGF,KFGF,KS3,Transforming protein KS3,hst,hst-1,kFGF |
| Uniprot Accession |
P08620,P11403,P48803
Additional SwissProt Accessions: P11403,P08620,P48803 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Cytokine Target |
| Disease | cancer |
| Disease from KEGG | MAPK signaling pathway, Ras signaling pathway, Rap1 signaling pathway, Calcium signaling pathway, PI3K-Akt signaling pathway, Regulation of actin cytoskeleton, Pathways in cancer, Chemical carcinogenesis - receptor activation, Melanoma, Breast cancer, Gastric cancer |
| Gene Ensembl | ENSECAG00000031103, ENSMUSG00000050917, ENSG00000075388, ENSCAFG00845015112, ENSBTAG00000012563, ENSMMUG00000057940 |
| Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.