Human TIRAP/BACTS1/Mal ORF/cDNA clone-Lentivirus particle (NM_001039661)

Cat. No.: vGMLP003281

Pre-made Human TIRAP/BACTS1/Mal Lentiviral expression plasmid for TIRAP lentivirus packaging, TIRAP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TIRAP/BACTS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003281 Human TIRAP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003281
Gene Name TIRAP
Accession Number NM_001039661
Gene ID 114609
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 666 bp
Gene Alias BACTS1,Mal,MyD88-2,wyatt
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCATCGACCTCCCTCCCAGCTCCTGGCTCTCGGCCTAAGAAGCCTCTAGGCAAGATGGCTGACTGGTTCAGGCAGACCCTGCTGAAGAAGCCCAAGAAGAGGCCCAACTCCCCAGAAAGCACCTCCAGCGATGCTTCACAGCCTACCTCACAGGACAGCCCACTACCCCCAAGCCTCAGCTCAGTCACGTCTCCCAGCCTGCCACCCACACATGCGAGTGACAGTGGCAGTAGTCGCTGGAGCAAAGACTATGACGTCTGCGTGTGCCACAGTGAGGAAGACCTGGTGGCCGCCCAGGACCTGGTCTCCTACTTGGAAGGCAGCACTGCCAGCCTGCGCTGCTTCCTGCAACTCCGGGATGCAACCCCAGGCGGCGCTATAGTGTCCGAGCTGTGCCAGGCACTGAGCAGTAGTCACTGCCGGGTGCTGCTCATCACGCCGGGCTTCCTTCAGGACCCCTGGTGCAAGTACCAGATGCTGCAGGCCCTGACCGAGGCTCCAGGGGCCGAGGGCTGCACCATCCCCCTGCTGTCGGGCCTCAGCAGAGCTGCCTACCCACCTGAGCTCCGATTCATGTACTACGTCGATGGCAGGGGCCCTGATGGTGGCTTTCGTCAAGTCAAAGAAGCTGTCATGCGTTATCTGCAGACACTCAGTTGA
ORF Protein Sequence MASSTSLPAPGSRPKKPLGKMADWFRQTLLKKPKKRPNSPESTSSDASQPTSQDSPLPPSLSSVTSPSLPPTHASDSGSSRWSKDYDVCVCHSEEDLVAAQDLVSYLEGSTASLRCFLQLRDATPGGAIVSELCQALSSSHCRVLLITPGFLQDPWCKYQMLQALTEAPGAEGCTIPLLSGLSRAAYPPELRFMYYVDGRGPDGGFRQVKEAVMRYLQTLS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T43814-Ab Anti-TIRAP monoclonal antibody
    Target Antigen GM-Tg-g-T43814-Ag TIRAP protein
    ORF Viral Vector pGMLP003281 Human TIRAP Lentivirus plasmid
    ORF Viral Vector vGMLP003281 Human TIRAP Lentivirus particle


    Target information

    Target ID GM-T43814
    Target Name TIRAP
    Gene Group Identifier
    (Target Gene ID in Homo species)
    114609
    Gene ID 100064503 (Equus caballus), 101088688 (Felis catus), 114609 (Homo sapiens), 117149 (Mus musculus)
    531079 (Bos taurus), 609544 (Canis lupus familiaris), 680127 (Rattus norvegicus), 714377 (Macaca mulatta)
    Gene Symbols & Synonyms TIRAP,Tirap,Mal,wyatt,BACTS1,MyD88-2,Wyatt,Tlr4ap,C130027E04Rik
    Target Alternative Names TIRAP,Toll/interleukin-1 receptor domain-containing adapter protein,TIR domain-containing adapter protein,Adaptor protein Wyatt, MyD88 adapter-like protein (MyD88-2),Mal,wyatt,BACTS1,MyD88-2
    Uniprot Accession P58753,Q99JY1
    Additional SwissProt Accessions: P58753,Q99JY1
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG NF-kappa B signaling pathway, Toll-like receptor signaling pathway, Alcoholic liver disease, Pathogenic Escherichia coli infection, Pertussis, Tuberculosis, Hepatitis B, PD-L1 expression and PD-1 checkpoint pathway in cancer, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000049250, ENSG00000150455, ENSMUSG00000032041, ENSBTAG00000021504, ENSCAFG00845009385, ENSMMUG00000051458
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.