Human TMED7/CGI-109/p24g3 ORF/cDNA clone-Lentivirus particle (NM_181836)

Cat. No.: vGMLP003031

Pre-made Human TMED7/CGI-109/p24g3 Lentiviral expression plasmid for TMED7 lentivirus packaging, TMED7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TMED7/CGI-109 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003031 Human TMED7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003031
Gene Name TMED7
Accession Number NM_181836
Gene ID 51014
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 675 bp
Gene Alias CGI-109,p24g3,p24gamma3,p27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGCGGCCGGGGTCCGCGCAGCGCTGGGCGGCCGTCGCGGGCCGTTGGGGGTGCAGGCTGCTCGCACTGCTGCTACTGGTGCCTGGACCCGGCGGCGCCTCTGAGATCACCTTCGAGCTTCCTGACAACGCCAAGCAGTGCTTCTACGAGGACATCGCTCAGGGCACCAAGTGCACCCTGGAGTTCCAGGTGATTACTGGTGGTCACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAAAGTGTTATACAAAGAGATGAAGAAACAGTATGATAGTTTTACCTTCACAGCCTCCAAAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCTACTTTCACACATAAAACTGTATATTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAGAACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTCATCGATTATCAGACTCATTTCCGTTTAAGAGAAGCTCAAGGCCGAAGCCGAGCAGAGGATCTAAATACAAGAGTGGCCTATTGGTCAGTAGGAGAAGCCCTCATTCTTCTGGTGGTTAGCATAGGGCAGGTATTTCTTTTGAAAAGCTTTTTCTCAGATAAAAGAACCACCACAACTCGTGTTGGATCATAA
ORF Protein Sequence MPRPGSAQRWAAVAGRWGCRLLALLLLVPGPGGASEITFELPDNAKQCFYEDIAQGTKCTLEFQVITGGHYDVDCRLEDPDGKVLYKEMKKQYDSFTFTASKNGTYKFCFSNEFSTFTHKTVYFDFQVGEDPPLFPSENRVSALTQMESACVSIHEALKSVIDYQTHFRLREAQGRSRAEDLNTRVAYWSVGEALILLVVSIGQVFLLKSFFSDKRTTTTRVGS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1951-Ab Anti-TMED7 monoclonal antibody
    Target Antigen GM-Tg-g-IP1951-Ag TMED7 protein
    ORF Viral Vector pGMLP003031 Human TMED7 Lentivirus plasmid
    ORF Viral Vector vGMLP003031 Human TMED7 Lentivirus particle


    Target information

    Target ID GM-IP1951
    Target Name TMED7
    Gene Group Identifier
    （Target Gene ID in Homo species)         		51014
    Gene ID 100125926 (Bos taurus), 100529263 (Equus caballus), 100533189 (Macaca mulatta), 101100690 (Felis catus)
    252889 (Rattus norvegicus), 481436 (Canis lupus familiaris), 51014 (Homo sapiens), 66676 (Mus musculus)
    Gene Symbols & Synonyms TMED7,Tmed7,p27,Tag,p24g3,CGI-109,p24gamma3,TRAM,3930401E15Rik,5830493P14Rik
    Target Alternative Names TMED7,Transmembrane emp24 domain-containing protein 7,p24 family protein gamma-3 (p24gamma3), p27,Tag,p27,p24g3,CGI-109,p24gamma3
    Uniprot Accession D3ZTX0,Q9Y3B3
    Additional SwissProt Accessions: D3ZTX0,Q9Y3B3
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSBTAG00000035030, ENSECAG00000040308, ENSCAFG00845005331, ENSG00000134970, ENSMUSG00000033184
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.