Human IGFBP4/BP-4/HT29-IGFBP ORF/cDNA clone-Lentivirus particle (NM_001552)

Cat. No.: vGMLP003022

Pre-made Human IGFBP4/BP-4/HT29-IGFBP Lentiviral expression plasmid for IGFBP4 lentivirus packaging, IGFBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IGFBP4/BP-4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003022 Human IGFBP4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003022
Gene Name IGFBP4
Accession Number NM_001552
Gene ID 3487
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 777 bp
Gene Alias BP-4,HT29-IGFBP,IBP4,IGFBP-4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCCCCTCTGCCTCGTGGCCGCCCTGCTGCTGGCCGCCGGGCCCGGGCCGAGCCTGGGCGACGAAGCCATCCACTGCCCGCCCTGCTCCGAGGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGCTGCGAGGAGCTGGTGCGAGAGCCGGGCTGCGGCTGTTGCGCCACTTGCGCCCTGGGCTTGGGGATGCCCTGCGGGGTGTACACCCCCCGTTGCGGCTCGGGCCTGCGCTGCTACCCGCCCCGAGGGGTGGAGAAGCCCCTGCACACACTGATGCACGGGCAAGGCGTGTGCATGGAGCTGGCGGAGATCGAGGCCATCCAGGAAAGCCTGCAGCCCTCTGACAAGGACGAGGGTGACCACCCCAACAACAGCTTCAGCCCCTGTAGCGCCCATGACCGCAGGTGCCTGCAGAAGCACTTCGCCAAAATTCGAGACCGGAGCACCAGTGGGGGCAAGATGAAGGTCAATGGGGCGCCCCGGGAGGATGCCCGGCCTGTGCCCCAGGGCTCCTGCCAGAGCGAGCTGCACCGGGCGCTGGAGCGGCTGGCCGCTTCACAGAGCCGCACCCACGAGGACCTCTACATCATCCCCATCCCCAACTGCGACCGCAACGGCAACTTCCACCCCAAGCAGTGTCACCCAGCTCTGGATGGGCAGCGTGGCAAGTGCTGGTGTGTGGACCGGAAGACGGGGGTGAAGCTTCCGGGGGGCCTGGAGCCAAAGGGGGAGCTGGACTGCCACCAGCTGGCTGACAGCTTTCGAGAGTGA
ORF Protein Sequence MLPLCLVAALLLAAGPGPSLGDEAIHCPPCSEEKLARCRPPVGCEELVREPGCGCCATCALGLGMPCGVYTPRCGSGLRCYPPRGVEKPLHTLMHGQGVCMELAEIEAIQESLQPSDKDEGDHPNNSFSPCSAHDRRCLQKHFAKIRDRSTSGGKMKVNGAPREDARPVPQGSCQSELHRALERLAASQSRTHEDLYIIPIPNCDRNGNFHPKQCHPALDGQRGKCWCVDRKTGVKLPGGLEPKGELDCHQLADSFRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0986-Ab Anti-IBP4/ IGFBP4/ BP-4 functional antibody
    Target Antigen GM-Tg-g-SE0986-Ag IGFBP4 protein
    Cytokine cks-Tg-g-GM-SE0986 insulin-like growth factor binding protein 4 (IGFBP4) protein & antibody
    ORF Viral Vector pGMLP003022 Human IGFBP4 Lentivirus plasmid
    ORF Viral Vector vGMLP003022 Human IGFBP4 Lentivirus particle


    Target information

    Target ID GM-SE0986
    Target Name IGFBP4
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3487
    Gene ID 100034062 (Equus caballus), 101082792 (Felis catus), 16010 (Mus musculus), 282262 (Bos taurus)
    3487 (Homo sapiens), 360622 (Rattus norvegicus), 608158 (Canis lupus familiaris), 700963 (Macaca mulatta)
    Gene Symbols & Synonyms IGFBP4,Igfbp4,IGFBP-4,Deb2,IBP-4,BP-4,IBP4,HT29-IGFBP,IGF-BP4
    Target Alternative Names BP-4,Deb2,HT29-IGFBP,IBP-4,IBP4,IGF-BP4,IGF-binding protein 4,IGFBP-4,IGFBP4,Igfbp4,Insulin-like growth factor-binding protein 4
    Uniprot Accession P21744,P22692,P47879,Q05716
    Additional SwissProt Accessions: P47879,Q05716,P22692,P21744
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease cancer, Pancreas Cancer, Dent disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000011271, ENSMUSG00000017493, ENSBTAG00000008611, ENSG00000141753, ENSCAFG00845008138, ENSMMUG00000009384
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.