Human AQP3/AQP-3/GIL ORF/cDNA clone-Lentivirus particle (NM_004925)

Cat. No.: vGMLP002932

Pre-made Human AQP3/AQP-3/GIL Lentiviral expression plasmid for AQP3 lentivirus packaging, AQP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AQP3/AQP-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002932 Human AQP3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002932
Gene Name AQP3
Accession Number NM_004925
Gene ID 360
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 879 bp
Gene Alias AQP-3,GIL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGTCGACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGACACTTGGATATGATCAATGGCTTCTTTGACCAGTTCATAGGCACAGCCTCCCTTATCGTGTGTGTGCTGGCCATTGTTGACCCCTACAACAACCCCGTCCCCCGAGGCCTGGAGGCCTTCACCGTGGGCCTGGTGGTCCTGGTCATTGGCACCTCCATGGGCTTCAACTCCGGCTATGCCGTCAACCCTGCCCGGGACTTTGGCCCCCGCCTTTTTACAGCCCTTGCGGGCTGGGGCTCTGCAGTCTTCACGACCGGCCAGCATTGGTGGTGGGTGCCCATCGTGTCCCCACTCCTGGGCTCCATTGCGGGTGTCTTCGTGTACCAGCTGATGATCGGCTGCCACCTGGAGCAGCCCCCACCCTCCAACGAGGAAGAGAATGTGAAGCTGGCCCATGTGAAGCACAAGGAGCAGATCTGA
ORF Protein Sequence MGRQKELVSRCGEMLHIRYRLLRQALAECLGTLILVMFGCGSVAQVVLSRGTHGGFLTINLAFGFAVTLGILIAGQVSGAHLNPAVTFAMCFLAREPWIKLPIYTLAQTLGAFLGAGIVFGLYYDAIWHFADNQLFVSGPNGTAGIFATYPSGHLDMINGFFDQFIGTASLIVCVLAIVDPYNNPVPRGLEAFTVGLVVLVIGTSMGFNSGYAVNPARDFGPRLFTALAGWGSAVFTTGQHWWWVPIVSPLLGSIAGVFVYQLMIGCHLEQPPPSNEEENVKLAHVKHKEQI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86226-Ab Anti-AQP3/ AQP-3/ GIL monoclonal antibody
    Target Antigen GM-Tg-g-T86226-Ag AQP3 VLP (virus-like particle)
    ORF Viral Vector pGMLP002932 Human AQP3 Lentivirus plasmid
    ORF Viral Vector pGMPC000831 Human AQP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002932 Human AQP3 Lentivirus particle


    Target information

    Target ID GM-T86226
    Target Name AQP3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    360
    Gene ID 100053851 (Equus caballus), 101101676 (Felis catus), 11828 (Mus musculus), 360 (Homo sapiens)
    611792 (Canis lupus familiaris), 65133 (Rattus norvegicus), 702721 (Macaca mulatta), 780866 (Bos taurus)
    Gene Symbols & Synonyms AQP3,Aqp3,AQP-2,GIL,AQP-3
    Target Alternative Names AQP-2,AQP-3,AQP3,Aqp3,Aquaglyceroporin-3,Aquaporin-3,GIL
    Uniprot Accession P47862,Q08DE6,Q8R2N1,Q92482
    Additional SwissProt Accessions: Q8R2N1,Q92482,P47862,Q08DE6
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000021134, ENSMUSG00000028435, ENSG00000165272, ENSCAFG00845021223, ENSMMUG00000003314, ENSBTAG00000008493
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.