Human EREG/Ep/EPR ORF/cDNA clone-Lentivirus particle (NM_001432)

Cat. No.: vGMLP002843

Pre-made Human EREG/Ep/EPR Lentiviral expression plasmid for EREG lentivirus packaging, EREG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to EREG/Epiregulin/EREG/Ep products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002843 Human EREG Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002843
Gene Name EREG
Accession Number NM_001432
Gene ID 2069
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 510 bp
Gene Alias Ep,EPR,ER
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGCGGGGAGGAGGATGGAGATGCTCTGTGCCGGCAGGGTCCCTGCGCTGCTGCTCTGCCTGGGTTTCCATCTTCTACAGGCAGTCCTCAGTACAACTGTGATTCCATCATGTATCCCAGGAGAGTCCAGTGATAACTGCACAGCTTTAGTTCAGACAGAAGACAATCCACGTGTGGCTCAAGTGTCAATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAGTGCATCTATCTGGTGGACATGAGTCAAAACTACTGCAGGTGTGAAGTGGGTTATACTGGTGTCCGATGTGAACACTTCTTTTTAACCGTCCACCAACCTTTAAGCAAAGAATATGTGGCTTTGACCGTGATTCTTATTATTTTGTTTCTTATCACAGTCGTCGGTTCCACATATTATTTCTGCAGATGGTACAGAAATCGAAAAAGTAAAGAACCAAAGAAGGAATATGAGAGAGTTACCTCAGGGGATCCAGAGTTGCCGCAAGTCTGA
ORF Protein Sequence MTAGRRMEMLCAGRVPALLLCLGFHLLQAVLSTTVIPSCIPGESSDNCTALVQTEDNPRVAQVSITKCSSDMNGYCLHGQCIYLVDMSQNYCRCEVGYTGVRCEHFFLTVHQPLSKEYVALTVILIILFLITVVGSTYYFCRWYRNRKSKEPKKEYERVTSGDPELPQV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T79157-Ab Anti-EREG/ EPR/ ER functional antibody
    Target Antigen GM-Tg-g-T79157-Ag EREG protein
    Cytokine cks-Tg-g-GM-T79157 epiregulin (EREG) protein & antibody
    ORF Viral Vector pGMLP002843 Human EREG Lentivirus plasmid
    ORF Viral Vector vGMLP002843 Human EREG Lentivirus particle


    Target information

    Target ID GM-T79157
    Target Name EREG/Epiregulin
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2069
    Gene ID 100056605 (Equus caballus), 100295476 (Bos taurus), 101093102 (Felis catus), 13874 (Mus musculus)
    2069 (Homo sapiens), 59325 (Rattus norvegicus), 611946 (Canis lupus familiaris), 702502 (Macaca mulatta)
    Gene Symbols & Synonyms EREG,Ereg,EPR,ER,Ep
    Target Alternative Names EPR,ER,EREG,Ep,Epiregulin,Ereg,Proepiregulin
    Uniprot Accession O14944,Q61521,Q9Z0L5
    Additional SwissProt Accessions: Q61521,O14944,Q9Z0L5
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer
    Disease from KEGG MAPK signaling pathway, ErbB signaling pathway, PI3K-Akt signaling pathway, Colorectal cancer
    Gene Ensembl ENSECAG00000007588, ENSBTAG00000010273, ENSMUSG00000029377, ENSG00000124882, ENSCAFG00845006658, ENSMMUG00000058506
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.