Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human BDKRB1/B1BKR/B1R ORF/cDNA clone-Lentivirus particle (NM_000710)
Cat. No.: vGMLP002722
Pre-made Human BDKRB1/B1BKR/B1R Lentiviral expression plasmid for BDKRB1 lentivirus packaging, BDKRB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
BDKRB1/B1BKR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002722 | Human BDKRB1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002722 |
| Gene Name | BDKRB1 |
| Accession Number | NM_000710 |
| Gene ID | 623 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1062 bp |
| Gene Alias | B1BKR,B1R,BDKRB2,BKB1R,BKR1,BRADYB1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCATCATCCTGGCCCCCTCTAGAGCTCCAATCCTCCAACCAGAGCCAGCTCTTCCCTCAAAATGCTACGGCCTGTGACAATGCTCCAGAAGCCTGGGACCTGCTGCACAGAGTGCTGCCAACATTTATCATCTCCATCTGTTTCTTCGGCCTCCTAGGGAACCTTTTTGTCCTGTTGGTCTTCCTCCTGCCCCGGCGGCAACTGAACGTGGCAGAAATCTACCTGGCCAACCTGGCAGCCTCTGATCTGGTGTTTGTCTTGGGCTTGCCCTTCTGGGCAGAGAATATCTGGAACCAGTTTAACTGGCCTTTCGGAGCCCTCCTCTGCCGTGTCATCAACGGGGTCATCAAGGCCAATTTGTTCATCAGCATCTTCCTGGTGGTGGCCATCAGCCAGGACCGCTACCGCGTGCTGGTGCACCCTATGGCCAGCCGGAGGCAGCAGCGGCGGAGGCAGGCCCGGGTCACCTGCGTGCTCATCTGGGTTGTGGGGGGCCTCTTGAGCATCCCCACATTCCTGCTGCGATCCATCCAAGCCGTCCCAGATCTGAACATCACCGCCTGCATCCTGCTCCTCCCCCATGAGGCCTGGCACTTTGCAAGGATTGTGGAGTTAAATATTCTGGGTTTCCTCCTACCACTGGCTGCGATCGTCTTCTTCAACTACCACATCCTGGCCTCCCTGCGAACGCGGGAGGAGGTCAGCAGGACAAGGTGCGGGGGCCGCAAGGATAGCAAGACCACAGCGCTGATCCTCACGCTCGTGGTTGCCTTCCTGGTCTGCTGGGCCCCTTACCACTTCTTTGCCTTCCTGGAATTCTTATTCCAGGTGCAAGCAGTCCGAGGCTGCTTTTGGGAGGACTTCATTGACCTGGGCCTGCAATTGGCCAACTTCTTTGCCTTCACTAACAGCTCCCTGAATCCAGTAATTTATGTCTTTGTGGGCCGGCTCTTCAGGACCAAGGTCTGGGAACTTTATAAACAATGCACCCCTAAAAGTCTTGCTCCAATATCTTCATCCCATAGGAAAGAAATCTTCCAACTTTTCTGGCGGAATTAA |
| ORF Protein Sequence | MASSWPPLELQSSNQSQLFPQNATACDNAPEAWDLLHRVLPTFIISICFFGLLGNLFVLLVFLLPRRQLNVAEIYLANLAASDLVFVLGLPFWAENIWNQFNWPFGALLCRVINGVIKANLFISIFLVVAISQDRYRVLVHPMASRRQQRRRQARVTCVLIWVVGGLLSIPTFLLRSIQAVPDLNITACILLLPHEAWHFARIVELNILGFLLPLAAIVFFNYHILASLRTREEVSRTRCGGRKDSKTTALILTLVVAFLVCWAPYHFFAFLEFLFQVQAVRGCFWEDFIDLGLQLANFFAFTNSSLNPVIYVFVGRLFRTKVWELYKQCTPKSLAPISSSHRKEIFQLFWRN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T58589-Ab | Anti-BKRB1/ BDKRB1/ B1BKR monoclonal antibody |
| Target Antigen | GM-Tg-g-T58589-Ag | BDKRB1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002722 | Human BDKRB1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP002722 | Human BDKRB1 Lentivirus particle |
Target information
| Target ID | GM-T58589 |
| Target Name | BDKRB1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
623 |
| Gene ID |
100054699 (Equus caballus), 12061 (Mus musculus), 490847 (Canis lupus familiaris), 532119 (Bos taurus) 623 (Homo sapiens), 712251 (Macaca mulatta), 81509 (Rattus norvegicus) |
| Gene Symbols & Synonyms | BDKRB1,Bdkrb1,B1R,BKR1,B1BKR,Bdkrb,BRADYB1,BKB1R,BKR,b1bkr |
| Target Alternative Names | B1 bradykinin receptor,B1BKR,B1R,BDKRB1,BK-1 receptor,BKB1R,BKR,BKR1,BRADYB1,Bdkrb,Bdkrb1,b1bkr |
| Uniprot Accession |
P46663,P97583,Q61125,Q8HZP2,Q9BDQ5
Additional SwissProt Accessions: Q61125,Q9BDQ5,P46663,Q8HZP2,P97583 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | Calcium signaling pathway, Neuroactive ligand-receptor interaction, Complement and coagulation cascades, Inflammatory mediator regulation of TRP channels, Regulation of actin cytoskeleton, Pathways in cancer |
| Gene Ensembl | ENSECAG00000005631, ENSMUSG00000041347, ENSCAFG00845003563, ENSG00000100739 |
| Target Classification | GPCR |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.