Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human HLA-DMA/D6S222E/DMA ORF/cDNA clone-Lentivirus particle (NM_006120)
Cat. No.: vGMLP002653
Pre-made Human HLA-DMA/D6S222E/DMA Lentiviral expression plasmid for HLA-DMA lentivirus packaging, HLA-DMA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HLA-DMA/D6S222E products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002653 | Human HLA-DMA Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002653 |
| Gene Name | HLA-DMA |
| Accession Number | NM_006120 |
| Gene ID | 3108 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 786 bp |
| Gene Alias | D6S222E,DMA,HLADM,RING6 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGTCATGAACAGAACCAAGGAGCTGCGCTGCTACAGATGTTACCACTTCTGTGGCTGCTACCCCACTCCTGGGCCGTCCCTGAAGCTCCTACTCCAATGTGGCCAGATGACCTGCAAAACCACACATTCCTGCACACAGTGTACTGCCAGGATGGGAGTCCCAGTGTGGGACTCTCTGAGGCCTACGACGAGGACCAGCTTTTCTTCTTCGACTTTTCCCAGAACACTCGGGTGCCTCGCCTGCCCGAATTTGCTGACTGGGCTCAGGAACAGGGAGATGCTCCTGCCATTTTATTTGACAAAGAGTTCTGCGAGTGGATGATCCAGCAAATAGGGCCAAAACTTGATGGGAAAATCCCGGTGTCCAGAGGGTTTCCTATCGCTGAAGTGTTCACGCTGAAGCCCCTGGAGTTTGGCAAGCCCAACACTTTGGTCTGTTTTGTCAGTAATCTCTTCCCACCCATGCTGACAGTGAACTGGCAGCATCATTCCGTCCCTGTGGAAGGATTTGGGCCTACTTTTGTCTCAGCTGTCGATGGACTCAGCTTCCAGGCCTTTTCTTACTTAAACTTCACACCAGAACCTTCTGACATTTTCTCCTGCATTGTGACTCACGAAATTGACCGCTACACAGCAATTGCCTATTGGGTACCCCGGAACGCACTGCCCTCAGATCTGCTGGAGAATGTGCTGTGTGGCGTGGCCTTTGGCCTGGGTGTGCTGGGCATCATCGTGGGCATTGTTCTCATCATCTACTTCCGGAAGCCTTGCTCAGGTGACTGA |
| ORF Protein Sequence | MGHEQNQGAALLQMLPLLWLLPHSWAVPEAPTPMWPDDLQNHTFLHTVYCQDGSPSVGLSEAYDEDQLFFFDFSQNTRVPRLPEFADWAQEQGDAPAILFDKEFCEWMIQQIGPKLDGKIPVSRGFPIAEVFTLKPLEFGKPNTLVCFVSNLFPPMLTVNWQHHSVPVEGFGPTFVSAVDGLSFQAFSYLNFTPEPSDIFSCIVTHEIDRYTAIAYWVPRNALPSDLLENVLCGVAFGLGVLGIIVGIVLIIYFRKPCSGD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0970-Ab | Anti-HLA-DMA monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0970-Ag | HLA-DMA protein |
| ORF Viral Vector | pGMLP002653 | Human HLA-DMA Lentivirus plasmid |
| ORF Viral Vector | vGMLP002653 | Human HLA-DMA Lentivirus particle |
Target information
| Target ID | GM-IP0970 |
| Target Name | HLA-DMA |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3108 |
| Gene ID |
100061035 (Equus caballus), 111560443 (Felis catus), 14998 (Mus musculus), 282490 (Bos taurus) 294274 (Rattus norvegicus), 3108 (Homo sapiens), 481732 (Canis lupus familiaris), 717870 (Macaca mulatta) |
| Gene Symbols & Synonyms | LOC100061035,LOC111560443,H2-DMa,BOLA-DMA,RT1-DMa,HLA-DMA,DLA-DMA,MAMU-DMA,H-2Ma,H2-Ma,DMA,DMA1,RT1.Ma,RT1.DMa,HLADM,RING6,D6S222E |
| Target Alternative Names | HLA-DMA,HLA class II histocompatibility antigen, DM alpha chain,MHC class II antigen DMA, Really interesting new gene 6 protein,DMA,HLADM,RING6,D6S222E |
| Uniprot Accession |
P28067,P28078
Additional SwissProt Accessions: P28078,P28067 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | |
| Disease | |
| Disease from KEGG | Phagosome, Cell adhesion molecules, Antigen processing and presentation, Hematopoietic cell lineage, Th1 and Th2 cell differentiation, Th17 cell differentiation, Intestinal immune network for IgA production, Type I diabetes mellitus, Leishmaniasis, Toxoplasmosis, Staphylococcus aureus infection, Tuberculosis, Influenza A, Human T-cell leukemia virus 1 infection, Epstein-Barr virus infection, Asthma, Autoimmune thyroid disease, Inflammatory bowel disease, Rheumatoid arthritis, Allograft rejection, Graft-versus-host disease, Viral myocarditis |
| Gene Ensembl | ENSECAG00000003669, ENSMUSG00000037649, ENSBTAG00000015730, ENSG00000204257, ENSCAFG00845018613, ENSMMUG00000022626 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.