Human TMED4/ERS25/GMP25iso ORF/cDNA clone-Lentivirus particle (NM_182547)

Cat. No.: vGMLP002599

Pre-made Human TMED4/ERS25/GMP25iso Lentiviral expression plasmid for TMED4 lentivirus packaging, TMED4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TMED4/ERS25 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002599 Human TMED4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002599
Gene Name TMED4
Accession Number NM_182547
Gene ID 222068
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 684 bp
Gene Alias ERS25,GMP25iso,HNLF,p24a3,p24alpha3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGGTGTCGGGGCTGGGCCTCTGCGGGCGATGGGGCGGCAGGCCCTGCTGCTTCTCGCGCTGTGCGCCACAGGCGCCCAGGGGCTCTACTTCCACATCGGCGAGACCGAGAAGCGCTGTTTCATCGAGGAAATCCCCGACGAGACCATGGTCATCGGCAACTATCGTACCCAGATGTGGGATAAGCAGAAGGAGGTCTTCCTGCCCTCGACCCCTGGCCTGGGCATGCACGTGGAAGTGAAGGACCCCGACGGCAAGGTGGTGCTGTCCCGGCAGTACGGCTCGGAGGGCCGCTTCACGTTCACCTCCCACACGCCCGGTGACCATCAAATCTGTCTGCACTCCAATTCTACCAGGATGGCTCTCTTCGCTGGTGGCAAACTGCGGGTGCATCTCGACATCCAGGTTGGGGAGCATGCCAACAACTACCCTGAGATTGCTGCAAAAGATAAGCTGACGGAGCTACAGCTCCGCGCCCGCCAGTTGCTTGATCAGGTGGAACAGATTCAGAAGGAGCAGGATTACCAAAGGTATCGTGAAGAGCGCTTCCGACTGACGAGCGAGAGCACCAACCAGAGGGTCCTATGGTGGTCCATTGCTCAGACTGTCATCCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAG
ORF Protein Sequence MAGVGAGPLRAMGRQALLLLALCATGAQGLYFHIGETEKRCFIEEIPDETMVIGNYRTQMWDKQKEVFLPSTPGLGMHVEVKDPDGKVVLSRQYGSEGRFTFTSHTPGDHQICLHSNSTRMALFAGGKLRVHLDIQVGEHANNYPEIAAKDKLTELQLRARQLLDQVEQIQKEQDYQRYREERFRLTSESTNQRVLWWSIAQTVILILTGIWQMRHLKSFFEAKKLV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0509-Ab Anti-TMED4/ ERS25/ GMP25iso functional antibody
    Target Antigen GM-Tg-g-SE0509-Ag TMED4 protein
    ORF Viral Vector pGMLP002599 Human TMED4 Lentivirus plasmid
    ORF Viral Vector vGMLP002599 Human TMED4 Lentivirus particle


    Target information

    Target ID GM-SE0509
    Target Name TMED4
    Gene Group Identifier
    (Target Gene ID in Homo species)
    222068
    Gene ID 100065195 (Equus caballus), 101095809 (Felis catus), 103694 (Mus musculus), 222068 (Homo sapiens)
    305502 (Rattus norvegicus), 475498 (Canis lupus familiaris), 508729 (Bos taurus), 699105 (Macaca mulatta)
    Gene Symbols & Synonyms TMED4,Tmed4,1110014L17Rik,HNLF,ERS25,p24a3,GMP25iso,p24alpha3,RGD1306319
    Target Alternative Names TMED4,Transmembrane emp24 domain-containing protein 4,Endoplasmic reticulum stress-response protein 25 (ERS25), GMP25iso, Putative NF-kappa-B-activating protein 156, p24 family protein alpha-3 (p24alpha3),HNLF,ERS25,p24a3,GMP25iso,p24alpha3
    Uniprot Accession Q7Z7H5,Q8R1V4
    Additional SwissProt Accessions: Q8R1V4,Q7Z7H5
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSMUSG00000004394, ENSG00000158604, ENSCAFG00845012302, ENSBTAG00000010612, ENSMMUG00000002650
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.