Human PPIB/CYP-S1/CYPB ORF/cDNA clone-Lentivirus particle (NM_000942)

Cat. No.: vGMLP002164

Pre-made Human PPIB/CYP-S1/CYPB Lentiviral expression plasmid for PPIB lentivirus packaging, PPIB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to Cyclophilin B/PPIB/PPIB/CYP-S1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002164 Human PPIB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002164
Gene Name PPIB
Accession Number NM_000942
Gene ID 5479
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 651 bp
Gene Alias CYP-S1,CYPB,HEL-S-39,OI9,SCYLP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAG
ORF Protein Sequence MLRLSERNMKVLLAAALIAGSVFFLLLPGPSAADEKKKGPKVTVKVYFDLRIGDEDVGRVIFGLFGKTVPKTVDNFVALATGEKGFGYKNSKFHRVIKDFMIQGGDFTRGDGTGGKSIYGERFPDENFKLKHYGPGWVSMANAGKDTNGSQFFITTVKTAWLDGKHVVFGKVLEGMEVVRKVESTKTDSRDKPLKDVIIADCGKIEVEKPFAIAKE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25847-Ab Anti-PPIB/ B/ CYP-S1 functional antibody
    Target Antigen GM-Tg-g-T25847-Ag PPIB protein
    ORF Viral Vector pGMLP002164 Human PPIB Lentivirus plasmid
    ORF Viral Vector pGMPC001690 Human PPIB Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002164 Human PPIB Lentivirus particle


    Target information

    Target ID GM-T25847
    Target Name Cyclophilin B/PPIB
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5479
    Gene ID 100066834 (Equus caballus), 101087581 (Felis catus), 19035 (Mus musculus), 281419 (Bos taurus)
    478337 (Canis lupus familiaris), 5479 (Homo sapiens), 64367 (Rattus norvegicus), 706757 (Macaca mulatta)
    Gene Symbols & Synonyms PPIB,Ppib,Cphn2,Cphn-2,CyP-20b,OI9,CYPB,SCYLP,CYP-S1,HEL-S-39,CypB,Scylp
    Target Alternative Names Cyclophilin B, PPIB,Peptidyl-prolyl cis-trans isomerase B,PPIase B,CYP-S1, Cyclophilin B, Rotamase B, S-cyclophilin (SCYLP),OI9,CYPB,SCYLP,CYP-S1,HEL-S-39
    Uniprot Accession P23284,P24368,P24369,P80311
    Additional SwissProt Accessions: P24369,P80311,P23284,P24368
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSMUSG00000032383, ENSBTAG00000016822, ENSCAFG00845022646, ENSG00000166794, ENSMMUG00000045241
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.