Human LGALS1/GAL1/GBP ORF/cDNA clone-Lentivirus particle (NM_002305.3)
Cat. No.: vGMLP001964
Pre-made Human LGALS1/GAL1/GBP Lentiviral expression plasmid for LGALS1 lentivirus packaging, LGALS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
Galectin-1/LGALS1/LGALS1/GAL1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001964 | Human LGALS1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001964 |
| Gene Name | LGALS1 |
| Accession Number | NM_002305.3 |
| Gene ID | 3956 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 408 bp |
| Gene Alias | GAL1,GBP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA |
| ORF Protein Sequence | MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T09544-Ab | Anti-LEG1/ LGALS1/ GAL1 functional antibody |
| Target Antigen | GM-Tg-g-T09544-Ag | LGALS1 protein |
| ORF Viral Vector | pGMLP001964 | Human LGALS1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000545 | Human LGALS1 Adenovirus plasmid |
| ORF Viral Vector | pGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAP000003 | Human LGALS1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP001964 | Human LGALS1 Lentivirus particle |
| ORF Viral Vector | vGMAD000545 | Human LGALS1 Adenovirus particle |
| ORF Viral Vector | vGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000003 | Human LGALS1 Adenovirus particle |
Target information
| Target ID | GM-T09544 |
| Target Name | Galectin-1/LGALS1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
3956 |
| Gene ID |
100069841 (Equus caballus), 101098151 (Felis catus), 16852 (Mus musculus), 326598 (Bos taurus) 3956 (Homo sapiens), 56646 (Rattus norvegicus), 610276 (Canis lupus familiaris) |
| Gene Symbols & Synonyms | LGALS1,Lgals1,galectin-1,L14,Gal-1,Galbp,L-14.5,Lect14,GBP,GAL1 |
| Target Alternative Names | 14 kDa laminin-binding protein (HLBP14),14 kDa lectin,Beta-galactoside-binding lectin L-14-I,GAL1,GBP,Gal-1,Galaptin,Galbp,Galectin-1,HBL,HPL,L-14.5,L14,LGALS1,Lactose-binding lectin 1,Lect14,Lectin galactoside-binding soluble 1,Lgals1,Putative MAPK-activating protein PM12,S-Lac lectin 1,galectin-1 |
| Uniprot Accession |
P09382,P11116,P11762,P16045
Additional SwissProt Accessions: P16045,P11116,P09382,P11762 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | cancer, Congenital occlusion of ureteropelvic junction |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000006745, ENSMUSG00000068220, ENSBTAG00000015089, ENSG00000100097, ENSCAFG00845005881 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


