Human GALR2/GAL2-R/GALNR2 ORF/cDNA clone-Lentivirus particle (NM_003857)

Cat. No.: vGMLP001510

Pre-made Human GALR2/GAL2-R/GALNR2 Lentiviral expression plasmid for GALR2 lentivirus packaging, GALR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GALR2/GAL2-R/GALR2/GAL2-R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001510 Human GALR2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001510
Gene Name GALR2
Accession Number NM_003857
Gene ID 8811
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1164 bp
Gene Alias GAL2-R,GALNR2,GALR-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACGTCTCGGGCTGCCCAGGGGCCGGGAACGCGAGCCAGGCGGGCGGCGGGGGAGGCTGGCACCCCGAGGCGGTCATCGTGCCCCTGCTCTTCGCGCTCATCTTCCTCGTGGGCACCGTGGGCAACACGCTGGTGCTGGCGGTGCTGCTGCGCGGCGGCCAGGCGGTCAGCACTACCAACCTGTTCATCCTTAACCTGGGCGTGGCCGACCTGTGTTTCATCCTGTGCTGCGTGCCCTTCCAGGCCACCATCTACACCCTGGACGGCTGGGTGTTCGGCTCGCTGCTGTGCAAGGCGGTGCACTTCCTCATCTTCCTCACCATGCACGCCAGCAGCTTCACGCTGGCCGCCGTCTCCCTGGACAGGTATCTGGCCATCCGCTACCCGCTGCACTCCCGCGAGCTGCGCACGCCTCGAAACGCGCTGGCAGCCATCGGGCTCATCTGGGGGCTGTCGCTGCTCTTCTCCGGGCCCTACCTGAGCTACTACCGCCAGTCGCAGCTGGCCAACCTGACCGTGTGCCATCCCGCGTGGAGCGCCCCTCGCCGCCGCGCCATGGACATCTGCACCTTCGTCTTCAGCTACCTGCTTCCTGTGCTGGTTCTCGGCCTGACCTACGCGCGCACCTTGCGCTACCTCTGGCGCGCCGTCGACCCGGTGGCCGCGGGCTCGGGTGCCCGGCGCGCCAAGCGCAAGGTGACACGCATGATCCTCATCGTGGCCGCGCTCTTCTGCCTCTGCTGGATGCCCCACCACGCGCTCATCCTCTGCGTGTGGTTCGGCCAGTTCCCGCTCACGCGCGCCACTTATGCGCTTCGCATCCTCTCGCACCTGGTCTCCTACGCCAACTCCTGCGTCAACCCCATCGTTTACGCGCTGGTCTCCAAGCACTTCCGCAAAGGCTTCCGCACGATCTGCGCGGGCCTGCTGGGCCGTGCCCCAGGCCGAGCCTCGGGCCGTGTGTGCGCTGCCGCGCGGGGCACCCACAGTGGCAGCGTGTTGGAGCGCGAGTCCAGCGACCTGTTGCACATGAGCGAGGCGGCGGGGGCCCTTCGTCCCTGCCCCGGCGCTTCCCAGCCATGCATCCTCGAGCCCTGTCCTGGCCCGTCCTGGCAGGGCCCAAAGGCAGGCGACAGCATCCTGACGGTTGATGTGGCCTGA
ORF Protein Sequence MNVSGCPGAGNASQAGGGGGWHPEAVIVPLLFALIFLVGTVGNTLVLAVLLRGGQAVSTTNLFILNLGVADLCFILCCVPFQATIYTLDGWVFGSLLCKAVHFLIFLTMHASSFTLAAVSLDRYLAIRYPLHSRELRTPRNALAAIGLIWGLSLLFSGPYLSYYRQSQLANLTVCHPAWSAPRRRAMDICTFVFSYLLPVLVLGLTYARTLRYLWRAVDPVAAGSGARRAKRKVTRMILIVAALFCLCWMPHHALILCVWFGQFPLTRATYALRILSHLVSYANSCVNPIVYALVSKHFRKGFRTICAGLLGRAPGRASGRVCAAARGTHSGSVLERESSDLLHMSEAAGALRPCPGASQPCILEPCPGPSWQGPKAGDSILTVDVA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13453-Ab Anti-GALR2/ GAL2-R/ GALNR2 monoclonal antibody
    Target Antigen GM-Tg-g-T13453-Ag GAL2-R/GALR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001510 Human GALR2 Lentivirus plasmid
    ORF Viral Vector vGMLP001510 Human GALR2 Lentivirus particle


    Target information

    Target ID GM-T13453
    Target Name GALR2/GAL2-R
    Gene Group Identifier
    (Target Gene ID in Homo species)
    8811
    Gene ID 100051251 (Equus caballus), 101096429 (Felis catus), 14428 (Mus musculus), 29234 (Rattus norvegicus)
    483325 (Canis lupus familiaris), 618629 (Bos taurus), 705684 (Macaca mulatta), 8811 (Homo sapiens)
    Gene Symbols & Synonyms GALR2,Galr2,mGalR,GAL2-R,GALR-2,GALNR2
    Target Alternative Names GAL2-R,GALNR2,GALR-2,GALR2,Galanin receptor type 2,Galr2,mGalR
    Uniprot Accession O08726,O43603,O88854
    Additional SwissProt Accessions: O88854,O08726,O43603
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Neuroactive ligand-receptor interaction
    Gene Ensembl ENSMUSG00000020793, ENSBTAG00000024910, ENSMMUG00000049812, ENSG00000182687
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.