Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human IL15RA/CD215 ORF/cDNA clone-Lentivirus particle (NM_002189)
Cat. No.: vGMLP001006
Pre-made Human IL15RA/CD215 Lentiviral expression plasmid for IL15RA lentivirus packaging, IL15RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL-15RA/IL15RA/CD215/IL15RA/CD215 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001006 | Human IL15RA Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001006 |
| Gene Name | IL15RA |
| Accession Number | NM_002189 |
| Gene ID | 3601 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 804 bp |
| Gene Alias | CD215 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCCCGCGGCGGGCGCGCGGCTGCCGGACCCTCGGTCTCCCGGCGCTGCTACTGCTGCTGCTGCTCCGGCCGCCGGCGACGCGGGGCATCACGTGCCCTCCCCCCATGTCCGTGGAACACGCAGACATCTGGGTCAAGAGCTACAGCTTGTACTCCAGGGAGCGGTACATTTGTAACTCTGGTTTCAAGCGTAAAGCCGGCACGTCCAGCCTGACGGAGTGCGTGTTGAACAAGGCCACGAATGTCGCCCACTGGACAACCCCCAGTCTCAAATGCATTAGAGACCCTGCCCTGGTTCACCAAAGGCCAGCGCCACCCTCCACAGTAACGACGGCAGGGGTGACCCCACAGCCAGAGAGCCTCTCCCCTTCTGGAAAAGAGCCCGCAGCTTCATCTCCCAGCTCAAACAACACAGCGGCCACAACAGCAGCTATTGTCCCGGGCTCCCAGCTGATGCCTTCAAAATCACCTTCCACAGGAACCACAGAGATAAGCAGTCATGAGTCCTCCCACGGCACCCCCTCTCAGACAACAGCCAAGAACTGGGAACTCACAGCATCCGCCTCCCACCAGCCGCCAGGTGTGTATCCACAGGGCCACAGCGACACCACTGTGGCTATCTCCACGTCCACTGTCCTGCTGTGTGGGCTGAGCGCTGTGTCTCTCCTGGCATGCTACCTCAAGTCAAGGCAAACTCCCCCGCTGGCCAGCGTTGAAATGGAAGCCATGGAGGCTCTGCCGGTGACTTGGGGGACCAGCAGCAGAGATGAAGACTTGGAAAACTGCTCTCACCACCTATGA |
| ORF Protein Sequence | MAPRRARGCRTLGLPALLLLLLLRPPATRGITCPPPMSVEHADIWVKSYSLYSRERYICNSGFKRKAGTSSLTECVLNKATNVAHWTTPSLKCIRDPALVHQRPAPPSTVTTAGVTPQPESLSPSGKEPAASSPSSNNTAATTAAIVPGSQLMPSKSPSTGTTEISSHESSHGTPSQTTAKNWELTASASHQPPGVYPQGHSDTTVAISTSTVLLCGLSAVSLLACYLKSRQTPPLASVEMEAMEALPVTWGTSSRDEDLENCSHHL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-INN-928 | Pre-Made Nogapendekin Alfa Biosimilar, Recombinant Protein targeting IL15RA: Recombinant therapeutic protein targeting CD215 |
| Target Antibody | GM-Tg-g-T48429-Ab | Anti-I15RA/ IL15RA/ CD215 monoclonal antibody |
| Target Antigen | GM-Tg-g-T48429-Ag | IL15RA VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001006 | Human IL15RA Lentivirus plasmid |
| ORF Viral Vector | pGMLV001104 | Human IL15RA Lentivirus plasmid |
| ORF Viral Vector | vGMLP001006 | Human IL15RA Lentivirus particle |
| ORF Viral Vector | vGMLV001104 | Human IL15RA Lentivirus particle |
Target information
| Target ID | GM-T48429 |
| Target Name | IL-15RA/IL15RA/CD215 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3601 |
| Gene ID |
100070311 (Equus caballus), 101082243 (Felis catus), 16169 (Mus musculus), 3601 (Homo sapiens) 487141 (Canis lupus familiaris), 615030 (Bos taurus), 690369 (Rattus norvegicus), 712788 (Macaca mulatta) |
| Gene Symbols & Synonyms | IL15RA,Il15ra,IL-15RA,CD215 |
| Target Alternative Names | IL-15RA, IL15RA, CD215,Interleukin-15 receptor subunit alpha,IL-15 receptor subunit alpha, IL-15R-alpha, IL-15RA,CD215 |
| Uniprot Accession |
Q13261,Q60819
Additional SwissProt Accessions: Q60819,Q13261 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Lung Cancer |
| Disease from KEGG | Cytokine-cytokine receptor interaction, JAK-STAT signaling pathway, Intestinal immune network for IgA production, Human T-cell leukemia virus 1 infection, Pathways in cancer |
| Gene Ensembl | ENSECAG00000006776, ENSMUSG00000023206, ENSG00000134470, ENSCAFG00845002159, ENSBTAG00000006078, ENSMMUG00000015149 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.