Human IL13/IL-13/P600 ORF/cDNA clone-Lentivirus particle (NM_002188)
Cat. No.: vGMLP000547
Pre-made Human IL13/IL-13/P600 Lentiviral expression plasmid for IL13 lentivirus packaging, IL13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL-13/IL13/IL13/IL-13 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000547 | Human IL13 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000547 |
| Gene Name | IL13 |
| Accession Number | NM_002188 |
| Gene ID | 3596 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 441 bp |
| Gene Alias | IL-13,P600 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGA |
| ORF Protein Sequence | MHPLLNPLLLALGLMALLLTTVIALTCLGGFASPGPVPPSTALRELIEELVNITQNQKAPLCNGSMVWSINLTAGMYCAALESLINVSGCSAIEKTQRMLSGFCPHKVSAGQFSSLHVRDTKIEVAQFVKDLLLHLKKLFREGQFN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T29143 |
| Target Name | IL-13/IL13 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
3596 |
| Gene ID |
100034113 (Equus caballus), 101084678 (Felis catus), 116553 (Rattus norvegicus), 16163 (Mus musculus) 281247 (Bos taurus), 3596 (Homo sapiens), 442990 (Canis lupus familiaris), 574325 (Macaca mulatta) |
| Gene Symbols & Synonyms | IL13,Il13,IL-13,Il-13,P600 |
| Target Alternative Names | IL-13,IL13,Il-13,Il13,Interleukin-13,P600 |
| Uniprot Accession |
P20109,P35225,P42203,Q864V6,Q9N0W9,Q9XSV9
Additional SwissProt Accessions: P42203,P20109,Q9XSV9,P35225,Q9N0W9,Q864V6 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | cancer, Breast Cancer, asthma, Malignant neoplasm of bladder |
| Disease from KEGG | Cytokine-cytokine receptor interaction, JAK-STAT signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Fc epsilon RI signaling pathway, Pathways in cancer, Asthma, Inflammatory bowel disease |
| Gene Ensembl | ENSECAG00000009732, ENSMUSG00000020383, ENSBTAG00000015953, ENSG00000169194, ENSCAFG00845010953, ENSMMUG00000003131 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


