Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human MFF/C2orf33/EMPF2 ORF/cDNA clone-Lentivirus particle (NM_020194)
Cat. No.: vGMLP-SPh-099
Pre-made Human MFF/C2orf33/EMPF2 Lentiviral expression plasmid for MFF lentivirus packaging, MFF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MFF/C2orf33 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP-SPh-099 | Human MFF Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP-SPh-099 |
| Gene Name | MFF |
| Accession Number | NM_020194 |
| Gene ID | 56947 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1029 bp |
| Gene Alias | C2orf33,EMPF2,GL004 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGTAAAGGAACAAGCAGTGACACATCACTAGGAAGGGTGAGCAGGGCAGCATTTCCTTCTCCCACTGCTGCTGAGATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCCCAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGCTAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGACCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTACTTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGAAATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAGCTGGTCAGAAATGATTCTCTGTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGATTTCTGCACCGGAGTACACTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAGACCTGTGTTGCGTGGTGGGTCTGCTGCCGCCACTTCTAATCCTCATCATGACAACGTCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG |
| ORF Protein Sequence | MSKGTSSDTSLGRVSRAAFPSPTAAEMAEISRIQYEMEYTEGISQRMRVPEKLKVAPPNADLEQGFQEGVPNASVIMQVPERIVVAGNNEDVSFSRPADLDLIQSTPFKPLALKTPPRVLTLSERPLDFLDLERPPTTPQNEEIRAVGRLKRERSMSENAVRQNGQLVRNDSLWHRSDSAPRNKISRFQAPISAPEYTVTPSPQQARVCPPHMLPEDGANLSSARGILSLIQSSTRRAYQQILDVLDENRRPVLRGGSAAATSNPHHDNVRYGISNIDTTIEGTSDDLTVVDAASLRRQIIKLNRRLQLLEEENKERAKREMVMYSITVAFWLLNSWLWFRR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP1171-Ab | Anti-MFF monoclonal antibody |
| Target Antigen | GM-Tg-g-IP1171-Ag | MFF protein |
| ORF Viral Vector | pGMLP003558 | Human MFF Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-099 | Human MFF Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-239 | Human MFF Adenovirus plasmid |
| ORF Viral Vector | vGMLP003558 | Human MFF Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-099 | Human MFF Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-239 | Human MFF Adenovirus particle |
Target information
| Target ID | GM-IP1171 |
| Target Name | MFF |
|
Gene Group Identifier （Target Gene ID in Homo species) |
56947 |
| Gene ID |
100056853 (Equus caballus), 101087770 (Felis catus), 301563 (Rattus norvegicus), 477395 (Canis lupus familiaris) 506291 (Bos taurus), 56947 (Homo sapiens), 708489 (Macaca mulatta), 75734 (Mus musculus) |
| Gene Symbols & Synonyms | MFF,Mff,RGD1310230,C2orf33,C2H2orf33,EMPF2,GL004,5230400G24Rik |
| Target Alternative Names | MFF,Mitochondrial fission factor,EMPF2,GL004,C2orf33 |
| Uniprot Accession |
Q3ZCD8,Q4KM98,Q6PCP5,Q9GZY8
Additional SwissProt Accessions: Q4KM98,Q3ZCD8,Q9GZY8,Q6PCP5 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | |
| Disease | |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000004389, ENSCAFG00845015898, ENSBTAG00000021319, ENSG00000168958, ENSMMUG00000013246, ENSMUSG00000026150 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.