Human BMP7/OP-1 ORF/cDNA clone-Lentivirus particle (BC008584)

Cat. No.: vGMLP-SPh-070

Pre-made Human BMP7/OP-1 Lentiviral expression plasmid for BMP7 lentivirus packaging, BMP7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to BMP-7/BMP7/BMP7/OP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-SPh-070 Human BMP7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-SPh-070
Gene Name BMP7
Accession Number BC008584
Gene ID 655
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 579 bp
Gene Alias OP-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG
ORF Protein Sequence MHVRSLRAAAPHSFVALWAPLFLLRSALADFSLDNEVHSSFIHRRLRSQERREMQREILSILGLPHRPRPHLQGKHNSAPMFMLDLYNAMAVEEGGGPGGQGFSYPYKAVFSTQGPPLASLQDSHFLTDADMVMSFVNLVEHDKEFFHPRYHHREFRFDLSKIPEGEAVTAAEFRIYKDYIRERFDNETFRISVYQVLQEHLGRESDLFLLDSRTLWASEEGWLVFDITATSNHWVVNPRHNLGLQLSVETLDGQSINPKLAGLIGRHGPQNKQPFMVAFFKATEVHFRSIRSTGSKQRSQNRSKTPKNQEALRMANVAENSSSDQRQACKKHELYVSFRDLGWQDWIIAPEGYAAYYCEGECAFPLNSYMNATNHAIVQTLVHFINPETVPKPCCAPTQLNAISVLYFDDSSNVILKKYRNMVVRACGCH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50289-Ab Anti-BMP7/ OP-1 functional antibody
    Target Antigen GM-Tg-g-T50289-Ag BMP7 protein
    Cytokine cks-Tg-g-GM-T50289 bone morphogenetic protein 7 (BMP7) protein & antibody
    ORF Viral Vector pGMLV000318 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMLV000319 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAAV000461 Human BMP7 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000439 Human BMP7 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-070 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-210 Human BMP7 Adenovirus plasmid
    ORF Viral Vector vGMLV000318 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMLV000319 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAAV000461 Human BMP7 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000439 Human BMP7 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-070 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-210 Human BMP7 Adenovirus particle


    Target information

    Target ID GM-T50289
    Target Name BMP-7/BMP7
    Gene Group Identifier
    (Target Gene ID in Homo species)
    655
    Gene ID 100050299 (Equus caballus), 101094168 (Felis catus), 12162 (Mus musculus), 477270 (Canis lupus familiaris)
    540595 (Bos taurus), 655 (Homo sapiens), 696948 (Macaca mulatta), 85272 (Rattus norvegicus)
    Gene Symbols & Synonyms BMP7,Bmp7,OP1,OP-1,BMP-7
    Target Alternative Names BMP-7,BMP7,Bmp7,Bone morphogenetic protein 7,OP-1,OP1,Osteogenic protein 1 (OP-1)
    Uniprot Accession P18075,P23359,P34819
    Additional SwissProt Accessions: P23359,P34819,P18075
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, TGF-beta signaling pathway, Axon guidance, Hippo signaling pathway
    Gene Ensembl ENSECAG00000002918, ENSMUSG00000008999, ENSCAFG00845029691, ENSBTAG00000015362, ENSG00000101144, ENSMMUG00000004074
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.