Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human MAPK8/JNK/JNK-46 ORF/cDNA clone-Lentivirus particle (NM_001323302.1)
Cat. No.: vGMLP-SPh-056
Pre-made Human MAPK8/JNK/JNK-46 Lentiviral expression plasmid for MAPK8 lentivirus packaging, MAPK8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
JNK/MAPK8/JNK1/MAPK8/JNK products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP-SPh-056 | Human MAPK8 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP-SPh-056 |
| Gene Name | MAPK8 |
| Accession Number | NM_001323302.1 |
| Gene ID | 5599 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1155 bp |
| Gene Alias | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,PRKM8,SAPK1,SAPK1c |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAAATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTGCAGCAGTGA |
| ORF Protein Sequence | MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLAQVQQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T40097-Ab | Anti-JNK1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T40097-Ag | JNK1/MAPK8 protein |
| ORF Viral Vector | pGMLP005225 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000121 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMLP-SPh-013 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-056 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-153 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMAP-SPh-196 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000125 | Human MAPK8 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP005225 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMAD000121 | Human MAPK8 Adenovirus particle |
| ORF Viral Vector | vGMLP-SPh-013 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-056 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-153 | Human MAPK8 Adenovirus particle |
| ORF Viral Vector | vGMAP-SPh-196 | Human MAPK8 Adenovirus particle |
Target information
| Target ID | GM-T40097 |
| Target Name | JNK/MAPK8/JNK1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
5599 |
| Gene ID |
100051798 (Equus caballus), 101091310 (Felis catus), 116554 (Rattus norvegicus), 26419 (Mus musculus) 477746 (Canis lupus familiaris), 539941 (Bos taurus), 5599 (Homo sapiens), 711115 (Macaca mulatta) |
| Gene Symbols & Synonyms | MAPK8,Mapk8,JNK,JNK1,Prkm8,SAPK1,PRKM8,JNK-46,JNK1A2,SAPK1c,JNK21B1/2 |
| Target Alternative Names | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,MAP kinase 8,MAPK 8,MAPK8,Mapk8,Mitogen-activated protein kinase 8,PRKM8,Prkm8,SAPK1,SAPK1c,Stress-activated protein kinase 1c (SAPK1c),Stress-activated protein kinase JNK1,c-Jun N-terminal kinase 1 |
| Uniprot Accession |
P45983,P49185,Q91Y86
Additional SwissProt Accessions: P49185,Q91Y86,P45983 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer |
| Disease from KEGG | Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, cAMP signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Protein processing in endoplasmic reticulum, Apoptosis, Apoptosis - multiple species, Wnt signaling pathway, Osteoclast differentiation, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, C-type lectin receptor signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Inflammatory mediator regulation of TRP channels, GnRH signaling pathway, Prolactin signaling pathway, Adipocytokine signaling pathway, Relaxin signaling pathway, Type II diabetes mellitus, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Alzheimer disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis B, Measles, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Choline metabolism in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis |
| Gene Ensembl | ENSECAG00000008480, ENSMUSG00000021936, ENSCAFG00845019380, ENSBTAG00000007876, ENSG00000107643, ENSMMUG00000004060 |
| Target Classification | Kinase, Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.