Human IL26/AK155/IL-26 ORF/cDNA clone-Lentivirus particle (NM_018402)
Cat. No.: vGMLP-IL-033
Pre-made Human IL26/AK155/IL-26 Lentiviral expression plasmid for IL26 lentivirus packaging, IL26 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL26/AK155 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP-IL-033 | Human IL26 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP-IL-033 |
Gene Name | IL26 |
Accession Number | NM_018402 |
Gene ID | 55801 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 516 bp |
Gene Alias | AK155,IL-26 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGTGAATTTCATTTTGAGGTGTGGGTTGCTGTTAGTCACTCTGTCTCTTGCCATTGCCAAGCACAAGCAATCTTCCTTCACCAAAAGTTGTTACCCAAGGGGAACATTGTCCCAAGCTGTTGACGCTCTCTATATCAAAGCAGCATGGCTCAAAGCAACGATTCCAGAAGACCGCATAAAAAATATACGATTATTAAAAAAGAAAACAAAAAAGCAGTTTATGAAAAACTGTCAATTTCAAGAACAGCTTCTGTCCTTCTTCATGGAAGACGTTTTTGGTCAACTGCAATTGCAAGGCTGCAAGAAAATACGCTTTGTGGAGGACTTTCATAGCCTTAGGCAGAAATTGAGCCACTGTATTTCCTGTGCTTCATCAGCTAGAGAGATGAAATCCATTACCAGGATGAAAAGAATATTTTATAGGATTGGAAACAAAGGAATCTACAAAGCCATCAGTGAACTGGATATTCTTCTTTCCTGGATTAAAAAATTATTGGAAAGCAGTCAGTAA |
ORF Protein Sequence | MLVNFILRCGLLLVTLSLAIAKHKQSSFTKSCYPRGTLSQAVDALYIKAAWLKATIPEDRIKNIRLLKKKTKKQFMKNCQFQEQLLSFFMEDVFGQLQLQGCKKIRFVEDFHSLRQKLSHCISCASSAREMKSITRMKRIFYRIGNKGIYKAISELDILLSWIKKLLESSQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1025-Ab | Anti-IL26/ AK155/ IL-26 functional antibody |
Target Antigen | GM-Tg-g-SE1025-Ag | IL26 protein |
Cytokine | cks-Tg-g-GM-SE1025 | interleukin 26 (IL26) protein & antibody |
ORF Viral Vector | pGMLP-IL-033 | Human IL26 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-116 | Human IL26 Adenovirus plasmid |
ORF Viral Vector | vGMLP-IL-033 | Human IL26 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-116 | Human IL26 Adenovirus particle |
Target information
Target ID | GM-SE1025 |
Target Name | IL26 |
Gene Group Identifier (Target Gene ID in Homo species) |
55801 |
Gene ID |
100629204 (Equus caballus), 101094939 (Felis catus), 55801 (Homo sapiens), 608923 (Canis lupus familiaris) 718027 (Macaca mulatta), 782075 (Bos taurus) |
Gene Symbols & Synonyms | IL26,AK155,IL-26 |
Target Alternative Names | IL26,Interleukin-26,IL-26,Protein AK155,AK155,IL-26 |
Uniprot Accession |
Q9NPH9
Additional SwissProt Accessions: Q9NPH9 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | |
Disease from KEGG | Cytokine-cytokine receptor interaction |
Gene Ensembl | ENSG00000111536, ENSCAFG00845013704, ENSMMUG00000004367, ENSBTAG00000052655 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.