Human IL18/IGIF/IL-18 ORF/cDNA clone-Lentivirus particle (NM_001562)
Cat. No.: vGMLP-IL-025
Pre-made Human IL18/IGIF/IL-18 Lentiviral expression plasmid for IL18 lentivirus packaging, IL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL-18/IL18/IL18/IGIF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP-IL-025 | Human IL18 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP-IL-025 |
Gene Name | IL18 |
Accession Number | NM_001562 |
Gene ID | 3606 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 582 bp |
Gene Alias | IGIF,IL-18,IL-1g,IL1F4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTTTACTTTATAGCTGAAGATGATGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTCCCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAAGAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACTGTTCAAAACGAAGACTAG |
ORF Protein Sequence | MAAEPVEDNCINFVAMKFIDNTLYFIAEDDENLESDYFGKLESKLSVIRNLNDQVLFIDQGNRPLFEDMTDSDCRDNAPRTIFIISMYKDSQPRGMAVTISVKCEKISTLSCENKIISFKEMNPPDNIKDTKSDIIFFQRSVPGHDNKMQFESSSYEGYFLACEKERDLFKLILKKEDELGDRSIMFTVQNED |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T06671-Ab | Anti-IL18/ IGIF/ IL-18 functional antibody |
Target Antigen | GM-Tg-g-T06671-Ag | IL18 protein |
Cytokine | cks-Tg-g-GM-T06671 | interleukin 18 (IL18) protein & antibody |
ORF Viral Vector | pGMLP002771 | Human IL18 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-025 | Human IL18 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-108 | Human IL18 Adenovirus plasmid |
ORF Viral Vector | vGMLP002771 | Human IL18 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-025 | Human IL18 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-108 | Human IL18 Adenovirus particle |
Target information
Target ID | GM-T06671 |
Target Name | IL-18/IL18 |
Gene Group Identifier (Target Gene ID in Homo species) |
3606 |
Gene ID |
100034216 (Equus caballus), 16173 (Mus musculus), 281249 (Bos taurus), 29197 (Rattus norvegicus) 3606 (Homo sapiens), 403796 (Canis lupus familiaris), 493688 (Felis catus), 574151 (Macaca mulatta) |
Gene Symbols & Synonyms | IL18,Il18,IGIF,IL-18,Igif,Il-18,IL-1 gamma,IL-1g,IL1F4 |
Target Alternative Names | IL-18, IL18,Interleukin-18,IL-18,Iboctadekin, Interferon gamma-inducing factor (IFN-gamma-inducing factor), Interleukin-1 gamma (IL-1 gamma),IGIF,IL-18,IL-1g,IL1F4 |
Uniprot Accession |
P70380,P97636,Q14116,Q95M33,Q9TU73,Q9XSQ7,Q9XSR0
Additional SwissProt Accessions: Q9XSQ7,P70380,Q9TU73,P97636,Q14116,Q9XSR0,Q95M33 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | cancer, Breast Cancer, Acute kidney failure, Overweight |
Disease from KEGG | Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, NOD-like receptor signaling pathway, Pathogenic Escherichia coli infection, Legionellosis, Yersinia infection, African trypanosomiasis, Malaria, Tuberculosis, Influenza A, Inflammatory bowel disease, Rheumatoid arthritis, Lipid and atherosclerosis |
Gene Ensembl | ENSECAG00000015261, ENSMUSG00000039217, ENSBTAG00000000277, ENSG00000150782, ENSCAFG00845001557, ENSMMUG00000064111 |
Target Classification | Cytokine Receptor |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.