Human IL1A/IL-1A/IL1 ORF/cDNA clone-Lentivirus particle (NM_000575)
Cat. No.: vGMLP-IL-001
Pre-made Human IL1A/IL-1A/IL1 Lentiviral expression plasmid for IL1A lentivirus packaging, IL1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL-1 alpha/IL1A/IL1A/IL-1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP-IL-001 | Human IL1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP-IL-001 |
| Gene Name | IL1A |
| Accession Number | NM_000575 |
| Gene ID | 3552 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 816 bp |
| Gene Alias | IL-1A,IL1,IL1-ALPHA,IL1F1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCAAAGTTCCAGACATGTTTGAAGACCTGAAGAACTGTTACAGTGAAAATGAAGAAGACAGTTCCTCCATTGATCATCTGTCTCTGAATCAGAAATCCTTCTATCATGTAAGCTATGGCCCACTCCATGAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCTTACCTTCAAGGAGAGCATGGTGGTAGTAGCAACCAACGGGAAGGTTCTGAAGAAGAGACGGTTGAGTTTAAGCCAATCCATCACTGATGATGACCTGGAGGCCATCGCCAATGACTCAGAGGAAGAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGCAATGTGAAATACAACTTTATGAGGATCATCAAATACGAATTCATCCTGAATGACGCCCTCAATCAAAGTATAATTCGAGCCAATGATCAGTACCTCACGGCTGCTGCATTACATAATCTGGATGAAGCAGTGAAATTTGACATGGGTGCTTATAAGTCATCAAAGGATGATGCTAAAATTACCGTGATTCTAAGAATCTCAAAAACTCAATTGTATGTGACTGCCCAAGATGAAGACCAACCAGTGCTGCTGAAGGAGATGCCTGAGATACCCAAAACCATCACAGGTAGTGAGACCAACCTCCTCTTCTTCTGGGAAACTCACGGCACTAAGAACTATTTCACATCAGTTGCCCATCCAAACTTGTTTATTGCCACAAAGCAAGACTACTGGGTGTGCTTGGCAGGGGGGCCACCCTCTATCACTGACTTTCAGATACTGGAAAACCAGGCGTAG |
| ORF Protein Sequence | MAKVPDMFEDLKNCYSENEEDSSSIDHLSLNQKSFYHVSYGPLHEGCMDQSVSLSISETSKTSKLTFKESMVVVATNGKVLKKRRLSLSQSITDDDLEAIANDSEEEIIKPRSAPFSFLSNVKYNFMRIIKYEFILNDALNQSIIRANDQYLTAAALHNLDEAVKFDMGAYKSSKDDAKITVILRISKTQLYVTAQDEDQPVLLKEMPEIPKTITGSETNLLFFWETHGTKNYFTSVAHPNLFIATKQDYWVCLAGGPPSITDFQILENQA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-063 | Pre-Made Bermekimab biosimilar, Whole mAb, Anti-IL1A Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha therapeutic antibody |
| Biosimilar | GMP-Bios-ab-331 | Pre-Made Lutikizumab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL1A;IL1B Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha;IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody |
| Target Antibody | GM-Tg-g-T16340-Ab | Anti-IL1A/ IL-1A/ IL1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T16340-Ag | IL1A VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T16340 | interleukin 1, alpha (IL1A) protein & antibody |
| ORF Viral Vector | pGMAP000157 | Human IL1A Adenovirus plasmid |
| ORF Viral Vector | pGMLP-IL-001 | Human IL1A Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-084 | Human IL1A Adenovirus plasmid |
| ORF Viral Vector | vGMAP000157 | Human IL1A Adenovirus particle |
| ORF Viral Vector | vGMLP-IL-001 | Human IL1A Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-084 | Human IL1A Adenovirus particle |
Target information
| Target ID | GM-T16340 |
| Target Name | IL-1 alpha/IL1A |
|
Gene Group Identifier (Target Gene ID in Homo species) |
3552 |
| Gene ID |
100064969 (Equus caballus), 16175 (Mus musculus), 24493 (Rattus norvegicus), 281250 (Bos taurus) 3552 (Homo sapiens), 403782 (Canis lupus familiaris), 493944 (Felis catus), 700193 (Macaca mulatta) |
| Gene Symbols & Synonyms | IL1A,Il1a,Il-1a,IL-1F1,IL-1 alpha,IL1,IL-1A,IL1F1,IL1-ALPHA,L1A |
| Target Alternative Names | Hematopoietin-1,IL-1 alpha,IL-1A,IL-1F1,IL1,IL1-ALPHA,IL1A,IL1F1,Il-1a,Il1a,Interleukin-1 alpha,L1A |
| Uniprot Accession |
O46612,O46613,P01582,P01583,P08831,P16598,P48089,Q28385
Additional SwissProt Accessions: Q28385,P01582,P16598,P08831,P01583,O46612,O46613,P48089 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | cancer, Sarcoidosis, ovarian cancer, Urinary bladder urothelial carcinoma |
| Disease from KEGG | MAPK signaling pathway, Cytokine-cytokine receptor interaction, Cellular senescence, Osteoclast differentiation, Hematopoietic cell lineage, AGE-RAGE signaling pathway in diabetic complications, Type I diabetes mellitus, Alzheimer disease, Pertussis, Leishmaniasis, Tuberculosis, Measles, Influenza A, Inflammatory bowel disease, Rheumatoid arthritis, Graft-versus-host disease, Fluid shear stress and atherosclerosis |
| Gene Ensembl | ENSECAG00000023727, ENSMUSG00000027399, ENSG00000115008, ENSCAFG00845011308, ENSMMUG00000052787 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


