Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human IFNB1/IFB/IFF ORF/cDNA clone-Adenovirus particle (BC096150)
Cat. No.: vGMAP000549
Pre-made Human IFNB1/IFB/IFF Adenovirus for IFNB1 overexpression in-vitro and in-vivo. The IFNB1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IFNB1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IFN beta/IFN beta1/IFNB1/IFNB1/IFB products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000549 | Human IFNB1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000549 |
| Gene Name | IFNB1 |
| Accession Number | BC096150 |
| Gene ID | 3456 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 564 bp |
| Gene Alias | IFB,IFF,MGC96956 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAACTGA |
| ORF Protein Sequence | MTNKCLLQIALLLCFSTTALSMSYNLLGFLQRSSNFQCQKLLWQLNGRLEYCLKDRMNFDIPEEIKQLQQFQKEDAALTIYEMLQNIFAIFRQDSSSTGWNETIVENLLANVYHQINHLKTVLEEKLEKEDFTRGKLMSSLHLKRYYGRILHYLKAKEYSHCAWTIVRVEILRNFYFINRLTGYLRN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T02808-Ab | Anti-IFNB/ IFNB1/ IFB functional antibody |
| Target Antigen | GM-Tg-g-T02808-Ag | IFNB1 protein |
| Cytokine | cks-Tg-g-GM-T02808 | interferon, beta 1, fibroblast (IFNB1) protein & antibody |
| ORF Viral Vector | pGMLP000557 | Human IFNB1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000549 | Human IFNB1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000557 | Human IFNB1 Lentivirus particle |
| ORF Viral Vector | vGMAP000549 | Human IFNB1 Adenovirus particle |
Target information
| Target ID | GM-T02808 |
| Target Name | IFN beta/IFN beta1/IFNB1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3456 |
| Gene ID |
100052545 (Equus caballus), 15977 (Mus musculus), 24481 (Rattus norvegicus), 3456 (Homo sapiens) 481558 (Canis lupus familiaris), 493849 (Felis catus), 711414 (Macaca mulatta) |
| Gene Symbols & Synonyms | IFNB1,Ifnb1,IFNB,IF1DA1,Ifb,If1da1,IFN-beta,Ifnb,IFB,IFF |
| Target Alternative Names | Fibroblast interferon,IF1DA1,IFB,IFF,IFN beta,IFN beta1,IFN-beta,IFNB,IFNB1,If1da1,Ifb,Ifnb,Ifnb1,Interferon beta |
| Uniprot Accession |
P01574,P01575,P05012,P70499,Q9N2J0
Additional SwissProt Accessions: P05012,P01575,P70499,P01574,Q9N2J0 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | |
| Disease from KEGG | Cytokine-cytokine receptor interaction, PI3K-Akt signaling pathway, Osteoclast differentiation, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, JAK-STAT signaling pathway, Natural killer cell mediated cytotoxicity, TNF signaling pathway, Alcoholic liver disease, Yersinia infection, Chagas disease, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Lipid and atherosclerosis |
| Gene Ensembl | ENSMUSG00000048806, ENSG00000171855, ENSCAFG00845016293, ENSMMUG00000019067 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.