Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human CRP/PTX1 ORF/cDNA clone-Adenovirus particle (BC125135)
Cat. No.: vGMAP000461
Pre-made Human CRP/PTX1 Adenovirus for CRP overexpression in-vitro and in-vivo. The CRP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CRP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
C-Reactive Protein/CRP/CRP/PTX1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000461 | Human CRP Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000461 |
| Gene Name | CRP |
| Accession Number | BC125135 |
| Gene ID | 1401 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 675 bp |
| Gene Alias | PTX1 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGACCCGTGGGTACAGTATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGTCTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGAGGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTCCGCCTCAGGGATCGTGGAGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGAAGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTGGGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCTGGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGATGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTGA |
| ORF Protein Sequence | MEKLLCFLVLTSLSHAFGQTDMSRKAFVFPKESDTSYVSLKAPLTKPLKAFTVCLHFYTELSSTRGYSIFSYATKRQDNEILIFWSKDIGYSFTVGGSEILFEVPEVTVAPVHICTSWESASGIVEFWVDGKPRVRKSLKKGYTVGAEASIILGQEQDSFGGNFEGSQSLVGDIGNVNMWDFVLSPDEINTIYLGGPFSPNVLNWRALKYEVQGEVFTKPQLWP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0824-Ab | Anti-CRP/ PTX1 functional antibody |
| Target Antigen | GM-Tg-g-SE0824-Ag | CRP protein |
| Cytokine | cks-Tg-g-GM-SE0824 | C-reactive protein, pentraxin-related (CRP) protein & antibody |
| ORF Viral Vector | pGMLV002473 | Human CRP Lentivirus plasmid |
| ORF Viral Vector | pGMAAV000165 | Human CRP Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAP000461 | Human CRP Adenovirus plasmid |
| ORF Viral Vector | vGMLV002473 | Human CRP Lentivirus particle |
| ORF Viral Vector | vGMAAV000165 | Human CRP Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000461 | Human CRP Adenovirus particle |
Target information
| Target ID | GM-SE0824 |
| Target Name | C-Reactive Protein/CRP |
|
Gene Group Identifier （Target Gene ID in Homo species) |
1401 |
| Gene ID |
101093079 (Felis catus), 12944 (Mus musculus), 138915014 (Equus caballus), 1401 (Homo sapiens) 25419 (Rattus norvegicus), 488629 (Canis lupus familiaris), 527553 (Bos taurus), 719454 (Macaca mulatta) |
| Gene Symbols & Synonyms | CRP,Crp,PTX1,Aa1249,Ac1262,Ab1-341,Ab2-196,Ac1-114,Ac2-069,Ba2-693 |
| Target Alternative Names | Aa1249,Ab1-341,Ab2-196,Ac1-114,Ac1262,Ac2-069,Ba2-693,C-Reactive Protein,C-reactive protein,CRP,Crp,PTX1 |
| Uniprot Accession |
P02741,P14847,P48199
Additional SwissProt Accessions: P14847,P02741,P48199 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Diagnostics Biomarker, Cytokine Target |
| Disease | cancer, Breast Cancer, cardiovascular disease, Pregnant state, pancreatic, renal, gastrointestinal, tissue damage, Acute coronary syndromes, Cardiovascular Diseases, cardiovascular events, cardiovascular outcome, coronary ischemic events, infections, Infectious disease: falciparum malaria, Infectious disease: AIDS, Infectious disease: ATL, Infectious disease: hepatitis, Infectious disease: herpes simplex, Infectious disease: syphilis, Infectious disease: TB, Inflammation, Inflammatory reactions, lymphoma, Mediastinal lympadenopathy, melanoma, myeloma, ovarian, Sepsis, neonatal infections, Non-small cell lung carcinoma |
| Disease from KEGG | |
| Gene Ensembl | ENSMUSG00000037942, ENSG00000132693, ENSCAFG00845030990, ENSMMUG00000008922 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.